Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRYAB cdna clone

CRYAB cDNA Clone

Gene Names
CRYAB; MFM2; CRYA2; CTPP2; HSPB5; CMD1II; CTRCT16; HEL-S-101
Synonyms
CRYAB; CRYAB cDNA Clone; CRYAB cdna clone
Ordering
For Research Use Only!
Sequence
atggacatcgccatccaccacccctggatccgccgccccttctttcctttccactcccccagccgcctctttgaccagttcttcggagagcacctgttggagtctgatcttttcccgacgtctacttccctgagtcccttctaccttcggccaccctccttcctgcgggcacccagctggtttgacactggactctcagagatgcgcctggaaaaggacaggttctctgtcaacctggatgtgaagcacttctccccagaggaactcaaagttaaggtgttgggagatgtgattgaggtgcatggaaaacatgaagagcgccaggatgaacatggtttcatctccagggagttccacaggaaataccggatcccagctgatgtagaccctctcaccattacttcatccctgtcatctgatggggtcctcactgtgaatggaccaaggaaacaggtctctggccctgagcgcaccattcccatcacccgtgaagagaagcctgctgtcaccgcagcccccaagaaatag
Sequence Length
528
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,159 Da
NCBI Official Full Name
Homo sapiens crystallin, alpha B, mRNA
NCBI Official Synonym Full Names
crystallin alpha B
NCBI Official Symbol
CRYAB
NCBI Official Synonym Symbols
MFM2; CRYA2; CTPP2; HSPB5; CMD1II; CTRCT16; HEL-S-101
NCBI Protein Information
alpha-crystallin B chain
UniProt Protein Name
Alpha-crystallin B chain
Protein Family
UniProt Gene Name
CRYAB
UniProt Synonym Gene Names
CRYA2; HSPB5; HspB5
UniProt Entry Name
CRYAB_HUMAN

NCBI Description

Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. Post-translational modifications decrease the ability to chaperone. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

CRYAB: a major structural protein of the eye lens. A member of the small heat shock protein (sHSP also known as the HSP20) family. Alpha-B is expressed in the lens as well as other tissues. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy.

Protein type: Chaperone; Heat shock protein

Chromosomal Location of Human Ortholog: 11q22.3-q23.1

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding; protein homodimerization activity; unfolded protein binding

Biological Process: muscle contraction; negative regulation of apoptosis; negative regulation of intracellular transport; protein homooligomerization

Disease: Cardiomyopathy, Dilated, 1ii; Cataract 16, Multiple Types; Myopathy, Myofibrillar, 2; Myopathy, Myofibrillar, Fatal Infantile Hypertonic, Alpha-b Crystallin-related

Research Articles on CRYAB

Similar Products

Product Notes

The CRYAB cryab (Catalog #AAA1272427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatcg ccatccacca cccctggatc cgccgcccct tctttccttt ccactccccc agccgcctct ttgaccagtt cttcggagag cacctgttgg agtctgatct tttcccgacg tctacttccc tgagtccctt ctaccttcgg ccaccctcct tcctgcgggc acccagctgg tttgacactg gactctcaga gatgcgcctg gaaaaggaca ggttctctgt caacctggat gtgaagcact tctccccaga ggaactcaaa gttaaggtgt tgggagatgt gattgaggtg catggaaaac atgaagagcg ccaggatgaa catggtttca tctccaggga gttccacagg aaataccgga tcccagctga tgtagaccct ctcaccatta cttcatccct gtcatctgat ggggtcctca ctgtgaatgg accaaggaaa caggtctctg gccctgagcg caccattccc atcacccgtg aagagaagcc tgctgtcacc gcagccccca agaaatag. It is sometimes possible for the material contained within the vial of "CRYAB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.