Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PXK cdna clone

PXK cDNA Clone

Gene Names
PXK; MONaKA
Synonyms
PXK; PXK cDNA Clone; PXK cdna clone
Ordering
For Research Use Only!
Sequence
atggccttcatggagaagccgccagccggcaaggtgctgctggacgacacggtgccgctgacagcagccatcgaggcgagccagagcctgcagtcccacacggaatatattattcgagtgcaaagaggaatttctgtggaaaacagctggcagattgttagaagatacagtgactttgatttgcttaacaacagcttacagattgcaggcctaagtctacctcttcctcccaaaaaattgattggtaacatggatcgtgaattcatagctgaaaggcagaaaggtcttcagaactatctcaacgtgatcacaacaaatcatatcttgtctaattgtgagctggttaagaagtttttagatccaaacaactattccgcaaactatactgagattgccttgcaacaggtttccatgttcttccgatcagaaccaaagtgggaggtggtggaacctttgaaagacataggttggagaataaggaagaaatatttcttgatgaagattaaaaatcagccaaaggaacggctagtgttaagctgggctgaccttggcccagacaagtatttgtcagataaagattttcagtgtctaatcaaacttctgccttcttgtttgcacccttacatctatcgggttacctttgccacagctaatgaatcctcagcgttgctaattaggatgtttaacgaaaagggaacattgaaggatctgatctacaaggcaaaaccaaaagacccatttctaaagaagtactgcaaccctaagaagattcagggcctggaactccagcaaataaaaacatatggacggcaaatattagaggtactgaagtttcttcatgacaagggattcccttatgggcatcttcacgcctccaatgtgatgctcgatggggacacttgtcggctgctggaccttgagaattccttattgggcctgccttccttctaccgatcttatttttcacaattcaggaaaatcaatacattggaaagtgtggatgtccactgctttggccacttactgtatgaaatgacttatggacgaccgccagactcggtgcctgtggactccttccctcctgccccgtccatggctgtggtggccgtgttggagtctacgctgtcttgtgaagcctgtaaaaatggcatgcctaccatctcccggctcttacagatgccattattcagcgatgttttactaaccacttctgaaaaaccacagtttaagatccctacaaagttaaaagaggcattgagaattgccaaagaatgtatagagaagagactaattgaggaacagaaacagattcaccagcatcgaagactgacaagagctcagtcccaccattga
Sequence Length
1353
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,762 Da
NCBI Official Full Name
Homo sapiens PX domain containing serine/threonine kinase, mRNA
NCBI Official Synonym Full Names
PX domain containing serine/threonine kinase like
NCBI Official Symbol
PXK
NCBI Official Synonym Symbols
MONaKA
NCBI Protein Information
PX domain-containing protein kinase-like protein
UniProt Protein Name
PX domain-containing protein kinase-like protein
UniProt Gene Name
PXK
UniProt Synonym Gene Names
MONaKA
UniProt Entry Name
PXK_HUMAN

NCBI Description

This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

Slob: Binds to and modulates brain Na,K-ATPase subunits ATP1B1 and ATP1B3 and may thereby participate in the regulation of electrical excitability and synaptic transmission. May not display kinase activity. Belongs to the protein kinase superfamily. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Protein kinase, Other; Other group; Slob family

Chromosomal Location of Human Ortholog: 3p14.3

Cellular Component: cytoplasm; microtubule organizing center; plasma membrane

Biological Process: inflammatory response; negative regulation of ATPase activity; negative regulation of ion transport; regulation of membrane potential; regulation of synaptic transmission

Research Articles on PXK

Similar Products

Product Notes

The PXK pxk (Catalog #AAA1272251) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccttca tggagaagcc gccagccggc aaggtgctgc tggacgacac ggtgccgctg acagcagcca tcgaggcgag ccagagcctg cagtcccaca cggaatatat tattcgagtg caaagaggaa tttctgtgga aaacagctgg cagattgtta gaagatacag tgactttgat ttgcttaaca acagcttaca gattgcaggc ctaagtctac ctcttcctcc caaaaaattg attggtaaca tggatcgtga attcatagct gaaaggcaga aaggtcttca gaactatctc aacgtgatca caacaaatca tatcttgtct aattgtgagc tggttaagaa gtttttagat ccaaacaact attccgcaaa ctatactgag attgccttgc aacaggtttc catgttcttc cgatcagaac caaagtggga ggtggtggaa cctttgaaag acataggttg gagaataagg aagaaatatt tcttgatgaa gattaaaaat cagccaaagg aacggctagt gttaagctgg gctgaccttg gcccagacaa gtatttgtca gataaagatt ttcagtgtct aatcaaactt ctgccttctt gtttgcaccc ttacatctat cgggttacct ttgccacagc taatgaatcc tcagcgttgc taattaggat gtttaacgaa aagggaacat tgaaggatct gatctacaag gcaaaaccaa aagacccatt tctaaagaag tactgcaacc ctaagaagat tcagggcctg gaactccagc aaataaaaac atatggacgg caaatattag aggtactgaa gtttcttcat gacaagggat tcccttatgg gcatcttcac gcctccaatg tgatgctcga tggggacact tgtcggctgc tggaccttga gaattcctta ttgggcctgc cttccttcta ccgatcttat ttttcacaat tcaggaaaat caatacattg gaaagtgtgg atgtccactg ctttggccac ttactgtatg aaatgactta tggacgaccg ccagactcgg tgcctgtgga ctccttccct cctgccccgt ccatggctgt ggtggccgtg ttggagtcta cgctgtcttg tgaagcctgt aaaaatggca tgcctaccat ctcccggctc ttacagatgc cattattcag cgatgtttta ctaaccactt ctgaaaaacc acagtttaag atccctacaa agttaaaaga ggcattgaga attgccaaag aatgtataga gaagagacta attgaggaac agaaacagat tcaccagcat cgaagactga caagagctca gtcccaccat tga. It is sometimes possible for the material contained within the vial of "PXK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.