Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

THOC7 cdna clone

THOC7 cDNA Clone

Gene Names
THOC7; fSAP24; hTREX30; NIF3L1BP1
Synonyms
THOC7; THOC7 cDNA Clone; THOC7 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagccgtgactgacgacgaagttatacggaagcgtctcctcattgatggagatggtgctggagatgatcggagaattaatctgctagtgaagagtttcattaaatggtgcaactctgggtcccaggaagagggatatagccagtaccaacgtatgctgagcacgctgtctcaatgtgaattttcaatgggcaaaactttactagtatatgatatgaatctcagagaaatggaaaattatgaaaaaatttacaaggaaatagaatgtagcatagctggagcacatgaaaaaattgctgagtgcaaaaagcaaattcttcaagcaaaacgaatacgaaaaaatcgccaagaatatgatgctttggcaaaagtgattcagcaccatccagacaggcatgagacattaaaggaactagaggctctgggaaaagaattagagcatctttcacacattaaagaaagtgttgaagataagctggaattgagacggaaacagtttcatgttcttcttagtaccatccatgaacttcagcaaacattggaaaatgatgaaaaactctcagaggtagaagaagctcaggaagcaagcatggaaacagatcctaagccatag
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,743 Da
NCBI Official Full Name
Homo sapiens THO complex 7 homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
THO complex 7
NCBI Official Symbol
THOC7
NCBI Official Synonym Symbols
fSAP24; hTREX30; NIF3L1BP1
NCBI Protein Information
THO complex subunit 7 homolog
UniProt Protein Name
THO complex subunit 7 homolog
Protein Family
UniProt Gene Name
THOC7
UniProt Synonym Gene Names
NIF3L1BP1; fSAP24; NIF3L1-binding protein 1
UniProt Entry Name
THOC7_HUMAN

Uniprot Description

THOC7: Component of the THO subcomplex of the TREX complex. The TREX complex specifically associates with spliced mRNA and not with unspliced pre-mRNA. It is recruited to spliced mRNAs by a transcription-independent mechanism. Binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export. The recruitment occurs via an interaction between ALYREF/THOC4 and the cap-binding protein NCBP1. DDX39B functions as a bridge between ALYREF/THOC4 and the THO complex. The TREX complex is essential for the export of Kaposi's sarcoma-associated herpesvirus (KSHV) intronless mRNAs and infectious virus production. The recruitment of the TREX complex to the intronless viral mRNA occurs via an interaction between KSHV ORF57 protein and ALYREF/THOC4. Belongs to the THOC7 family.

Protein type: Spliceosome; RNA splicing

Chromosomal Location of Human Ortholog: 3p14.1

Cellular Component: cytoplasm; nuclear chromosome, telomeric region; nucleoplasm; nucleus

Molecular Function: nucleic acid binding; protein binding

Biological Process: intronless viral mRNA export from host nucleus; mRNA 3'-end processing; mRNA export from nucleus; RNA elongation from RNA polymerase II promoter; RNA export from nucleus; termination of RNA polymerase II transcription

Research Articles on THOC7

Similar Products

Product Notes

The THOC7 thoc7 (Catalog #AAA1272165) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagccg tgactgacga cgaagttata cggaagcgtc tcctcattga tggagatggt gctggagatg atcggagaat taatctgcta gtgaagagtt tcattaaatg gtgcaactct gggtcccagg aagagggata tagccagtac caacgtatgc tgagcacgct gtctcaatgt gaattttcaa tgggcaaaac tttactagta tatgatatga atctcagaga aatggaaaat tatgaaaaaa tttacaagga aatagaatgt agcatagctg gagcacatga aaaaattgct gagtgcaaaa agcaaattct tcaagcaaaa cgaatacgaa aaaatcgcca agaatatgat gctttggcaa aagtgattca gcaccatcca gacaggcatg agacattaaa ggaactagag gctctgggaa aagaattaga gcatctttca cacattaaag aaagtgttga agataagctg gaattgagac ggaaacagtt tcatgttctt cttagtacca tccatgaact tcagcaaaca ttggaaaatg atgaaaaact ctcagaggta gaagaagctc aggaagcaag catggaaaca gatcctaagc catag. It is sometimes possible for the material contained within the vial of "THOC7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.