Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC4M cdna clone

CLEC4M cDNA Clone

Gene Names
CLEC4M; CD299; LSIGN; CD209L; L-SIGN; DCSIGNR; HP10347; DC-SIGN2; DC-SIGNR
Synonyms
CLEC4M; CLEC4M cDNA Clone; CLEC4M cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgactccaaggaaccaagggtgcagcagctgggcctcctggaagaagatccaacaaccagtggcatcagactttttccaagagactttcaattccagcagatacatggccacaagagctctacagggtgtcttggccatggcgccctggtgctgcaactcctctccttcatgctcttggctggggtcctggtggccatccttgtccaagtgtccaaggtccccagctccctaagtcaggaacaatccgagcaagacgcaatctaccagaacctgacccagcttaaagctgcagtgggtgagctctcagagaaatccaagctgcaggagatctaccaggagctgacccagctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccggctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacggagctgaaggctgcagtgggtgagttgccagagaaatccaagctgcaggagatctaccaggagctgacccagctgaaggctgcagtgggtgagttgccagaccagtccaagcagcagcaaatctatcaagaactgaccgatttgaagactgcatttgaacgcctgtgccgccactgtcccaaggactggacattcttccaaggaaactgttacttcatgtctaactcccagcggaactggcacgactccgtcaccgcctgccaggaagtgagggcccagctcgtcgtaatcaaaactgctgaggagcagaacttcctacagctgcagacttccaggagtaaccgcttctcctggatgggactttcagacctaaatcaggaaggcacgtggcaatgggtggacggctcacctctgtcacccagcttccagcggtactggaacagtggagaacccaacaatagcgggaatgaagactgtgcggaatttagtggcagtggctggaacgacaatcgatgtgacgttgacaattactggatctgcaaaaagcccgcagcctgcttcagagacgaatag
Sequence Length
1200
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,408 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 4, member M, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 4 member M
NCBI Official Symbol
CLEC4M
NCBI Official Synonym Symbols
CD299; LSIGN; CD209L; L-SIGN; DCSIGNR; HP10347; DC-SIGN2; DC-SIGNR
NCBI Protein Information
C-type lectin domain family 4 member M
UniProt Protein Name
C-type lectin domain family 4 member M
UniProt Gene Name
CLEC4M
UniProt Synonym Gene Names
CD209L; CD209L1; CD299; DC-SIGNR; DC-SIGN2; L-SIGN
UniProt Entry Name
CLC4M_HUMAN

NCBI Description

This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Uniprot Description

CLEC4M: Probable pathogen-recognition receptor involved in peripheral immune surveillance in liver. May mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. Probably recognizes in a calcium-dependent manner high mannose N-linked oligosaccharides in a variety of pathogen antigens, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S. Is a receptor for ICAM3, probably by binding to mannose-like carbohydrates. Is presumably a coreceptor for the SARS coronavirus. 10 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19p13

Cellular Component: integral to plasma membrane; membrane

Molecular Function: calcium-dependent protein binding; viral receptor activity; virion binding

Biological Process: cell-cell recognition; regulation of blood coagulation; regulation of gene expression; virion attachment to host cell surface receptor; virus-host interaction

Research Articles on CLEC4M

Similar Products

Product Notes

The CLEC4M clec4m (Catalog #AAA1272120) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgact ccaaggaacc aagggtgcag cagctgggcc tcctggaaga agatccaaca accagtggca tcagactttt tccaagagac tttcaattcc agcagataca tggccacaag agctctacag ggtgtcttgg ccatggcgcc ctggtgctgc aactcctctc cttcatgctc ttggctgggg tcctggtggc catccttgtc caagtgtcca aggtccccag ctccctaagt caggaacaat ccgagcaaga cgcaatctac cagaacctga cccagcttaa agctgcagtg ggtgagctct cagagaaatc caagctgcag gagatctacc aggagctgac ccagctgaag gctgcagtgg gtgagttgcc agagaaatcc aagctgcagg agatctacca ggagctgacc cggctgaagg ctgcagtggg tgagttgcca gagaaatcca agctgcagga gatctaccag gagctgaccc ggctgaaggc tgcagtgggt gagttgccag agaaatccaa gctgcaggag atctaccagg agctgacccg gctgaaggct gcagtgggtg agttgccaga gaaatccaag ctgcaggaga tctaccagga gctgacggag ctgaaggctg cagtgggtga gttgccagag aaatccaagc tgcaggagat ctaccaggag ctgacccagc tgaaggctgc agtgggtgag ttgccagacc agtccaagca gcagcaaatc tatcaagaac tgaccgattt gaagactgca tttgaacgcc tgtgccgcca ctgtcccaag gactggacat tcttccaagg aaactgttac ttcatgtcta actcccagcg gaactggcac gactccgtca ccgcctgcca ggaagtgagg gcccagctcg tcgtaatcaa aactgctgag gagcagaact tcctacagct gcagacttcc aggagtaacc gcttctcctg gatgggactt tcagacctaa atcaggaagg cacgtggcaa tgggtggacg gctcacctct gtcacccagc ttccagcggt actggaacag tggagaaccc aacaatagcg ggaatgaaga ctgtgcggaa tttagtggca gtggctggaa cgacaatcga tgtgacgttg acaattactg gatctgcaaa aagcccgcag cctgcttcag agacgaatag. It is sometimes possible for the material contained within the vial of "CLEC4M, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.