Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABAT cdna clone

ABAT cDNA Clone

Gene Names
ABAT; GABAT; NPD009; GABA-AT
Synonyms
ABAT; ABAT cDNA Clone; ABAT cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaccaccattcacccaagggtcagaggaggtttcaaagaaaaggtgtcattggagcagtgttttgcagaatgagccagagttcaccaagcaggcaaggcaaggaagggtgttgcagagagggaacagcatatgcaaaggcatatcagttcatggcatcacatctttcactggggaagccagtttccacaggcagcatcccaaggttcaataaggccttatttaacaagcaagcaaaatgcaaaccaaaccattattcatttattggcttaagtatgctttctcctgaaaactttagcattgggtgcaaatattcagtatggttctcggagaccaaagggttttaa
Sequence Length
351
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
18
Molecular Weight
56,439 Da
NCBI Official Full Name
Homo sapiens 4-aminobutyrate aminotransferase, mRNA
NCBI Official Synonym Full Names
4-aminobutyrate aminotransferase
NCBI Official Symbol
ABAT
NCBI Official Synonym Symbols
GABAT; NPD009; GABA-AT
NCBI Protein Information
4-aminobutyrate aminotransferase, mitochondrial
UniProt Protein Name
4-aminobutyrate aminotransferase, mitochondrial
UniProt Gene Name
ABAT
UniProt Synonym Gene Names
GABAT; GABA-AT; GABA transaminase; GABA-T
UniProt Entry Name
GABT_HUMAN

NCBI Description

4-aminobutyrate aminotransferase (ABAT) is responsible for catabolism of gamma-aminobutyric acid (GABA), an important, mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. The active enzyme is a homodimer of 50-kD subunits complexed to pyridoxal-5-phosphate. The protein sequence is over 95% similar to the pig protein. GABA is estimated to be present in nearly one-third of human synapses. ABAT in liver and brain is controlled by 2 codominant alleles with a frequency in a Caucasian population of 0.56 and 0.44. The ABAT deficiency phenotype includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ABAT: Catalyzes the conversion of gamma-aminobutyrate and L- beta-aminoisobutyrate to succinate semialdehyde and methylmalonate semialdehyde, respectively. Can also convert delta-aminovalerate and beta-alanine. Defects in ABAT are a cause of GABA transaminase deficiency (GABATD). The phenotype of this deficiency includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Belongs to the class-III pyridoxal-phosphate-dependent aminotransferase family.

Protein type: EC 2.6.1.19; EC 2.6.1.22; Mitochondrial; Carbohydrate Metabolism - propanoate; Other Amino Acids Metabolism - beta-alanine; Transferase; Amino Acid Metabolism - alanine, aspartate and glutamate; Carbohydrate Metabolism - butanoate; Amino Acid Metabolism - valine, leucine and isoleucine degradation

Chromosomal Location of Human Ortholog: 16p13.2

Cellular Component: 4-aminobutyrate transaminase complex; mitochondrial matrix; mitochondrion

Molecular Function: 4-aminobutyrate transaminase activity; protein homodimerization activity; pyridoxal phosphate binding; succinate-semialdehyde dehydrogenase binding

Biological Process: behavioral response to cocaine; gamma-aminobutyric acid catabolic process

Disease: Gaba-transaminase Deficiency

Research Articles on ABAT

Similar Products

Product Notes

The ABAT abat (Catalog #AAA1272090) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaacc accattcacc caagggtcag aggaggtttc aaagaaaagg tgtcattgga gcagtgtttt gcagaatgag ccagagttca ccaagcaggc aaggcaagga agggtgttgc agagagggaa cagcatatgc aaaggcatat cagttcatgg catcacatct ttcactgggg aagccagttt ccacaggcag catcccaagg ttcaataagg ccttatttaa caagcaagca aaatgcaaac caaaccatta ttcatttatt ggcttaagta tgctttctcc tgaaaacttt agcattgggt gcaaatattc agtatggttc tcggagacca aagggtttta a. It is sometimes possible for the material contained within the vial of "ABAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.