Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACADS cdna clone

ACADS cDNA Clone

Gene Names
ACADS; SCAD; ACAD3
Synonyms
ACADS; ACADS cDNA Clone; ACADS cdna clone
Ordering
For Research Use Only!
Sequence
atggccgccgcgctgctcgcccgggcctcgggccctgcccgcagagctctctgtcctagggcctggcggcagttacacaccatctaccagtctgtggaactgcccgagacacaccagatgttgctccagacatgccgggactttgccgagaaggagttgtttcccattgcagcccaggtggataaggaacatctcttcccagcggctcaggtgaagaagatgggcgggcttgggcttctggccatggacgtgcccgaggagcttggcggtgctggcctcgattacctggcctacgccatcgccatggaggagatcagccgcggctgcgcctccaccggagtcatcatgagtgtcaacaactctctctacctggggcccatcttgaagtttggctccaaggagcagaagcaggcgtgggtcacgcctttcaccagtggtgacaaaattggctgctttgccctcagcgaaccagggaacggcagtgatgcaggagctgcgtccaccaccgcccgggccgagggcgactcatgggttctgaatggaaccaaagcctggatcaccaatgcctgggaggcttcggctgccgtggtctttgccagcacggacagagccctgcaaaacaagagcatcagtgccttcctggtccccatgccaacgcctgggctcacgttggggaagaaagaagacaagctgggcatccggggctcatccacggccaacctcatctttgaggactgtcgcatccccaaggacagcatcctgggggagccagggatgggcttcaagatagccatgcaaaccctggacatgggccgcatcggcatcgcctcccaggccctgggcattgcccagaccgccctcgattgtgctgtgaactacgctgagaatcgcatggccttcggggcgcccctcaccaagctccaggtcatccagttcaagttggcagacatggccctggccctggagagtgcccggctgctgacctggcgtgctgccatgctgaaggataacaagaagcctttcatcaaggaggcagccatggccaagctggccgcctcggaggccgcgaccgccatcagccaccaggccatccagatcctgggcggcatgggctacgtgacagagatgccggcagagcggcactaccgcgacgcccgcatcactgagatctacgagggcaccagcgaaatccagcggctggtgatcgccgggcatctgctcaggagctaccggagctga
Sequence Length
1239
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
35
Molecular Weight
44,297 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase, C-2 to C-3 short chain
NCBI Official Symbol
ACADS
NCBI Official Synonym Symbols
SCAD; ACAD3
NCBI Protein Information
short-chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Protein Name
Short-chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Gene Name
ACADS
UniProt Synonym Gene Names
SCAD
UniProt Entry Name
ACADS_HUMAN

NCBI Description

This gene encodes a tetrameric mitochondrial flavoprotein, which is a member of the acyl-CoA dehydrogenase family. This enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Mutations in this gene have been associated with short-chain acyl-CoA dehydrogenase (SCAD) deficiency. Alternative splicing results in two variants which encode different isoforms. [provided by RefSeq, Oct 2014]

Uniprot Description

ACADS: Defects in ACADS are the cause of acyl-CoA dehydrogenase short-chain deficiency (ACADSD). It is an autosomal recessive disorder resulting in acute acidosis and muscle weakness in infants, and a form of lipid-storage myopathy in adults. Belongs to the acyl-CoA dehydrogenase family.

Protein type: EC 1.3.8.1; Lipid Metabolism - fatty acid; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Carbohydrate Metabolism - butanoate; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: mitochondrial matrix; mitochondrion; nucleus

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; butyryl-CoA dehydrogenase activity; electron carrier activity; FAD binding

Biological Process: butyrate catabolic process; fatty acid beta-oxidation; fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis

Disease: Acyl-coa Dehydrogenase, Short-chain, Deficiency Of

Research Articles on ACADS

Similar Products

Product Notes

The ACADS acads (Catalog #AAA1272065) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgccg cgctgctcgc ccgggcctcg ggccctgccc gcagagctct ctgtcctagg gcctggcggc agttacacac catctaccag tctgtggaac tgcccgagac acaccagatg ttgctccaga catgccggga ctttgccgag aaggagttgt ttcccattgc agcccaggtg gataaggaac atctcttccc agcggctcag gtgaagaaga tgggcgggct tgggcttctg gccatggacg tgcccgagga gcttggcggt gctggcctcg attacctggc ctacgccatc gccatggagg agatcagccg cggctgcgcc tccaccggag tcatcatgag tgtcaacaac tctctctacc tggggcccat cttgaagttt ggctccaagg agcagaagca ggcgtgggtc acgcctttca ccagtggtga caaaattggc tgctttgccc tcagcgaacc agggaacggc agtgatgcag gagctgcgtc caccaccgcc cgggccgagg gcgactcatg ggttctgaat ggaaccaaag cctggatcac caatgcctgg gaggcttcgg ctgccgtggt ctttgccagc acggacagag ccctgcaaaa caagagcatc agtgccttcc tggtccccat gccaacgcct gggctcacgt tggggaagaa agaagacaag ctgggcatcc ggggctcatc cacggccaac ctcatctttg aggactgtcg catccccaag gacagcatcc tgggggagcc agggatgggc ttcaagatag ccatgcaaac cctggacatg ggccgcatcg gcatcgcctc ccaggccctg ggcattgccc agaccgccct cgattgtgct gtgaactacg ctgagaatcg catggccttc ggggcgcccc tcaccaagct ccaggtcatc cagttcaagt tggcagacat ggccctggcc ctggagagtg cccggctgct gacctggcgt gctgccatgc tgaaggataa caagaagcct ttcatcaagg aggcagccat ggccaagctg gccgcctcgg aggccgcgac cgccatcagc caccaggcca tccagatcct gggcggcatg ggctacgtga cagagatgcc ggcagagcgg cactaccgcg acgcccgcat cactgagatc tacgagggca ccagcgaaat ccagcggctg gtgatcgccg ggcatctgct caggagctac cggagctga. It is sometimes possible for the material contained within the vial of "ACADS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.