Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRPE cdna clone

SNRPE cDNA Clone

Gene Names
SNRPE; SME; Sm-E; HYPT11; snRNP-E
Synonyms
SNRPE; SNRPE cDNA Clone; SNRPE cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtaccgtggccagggtcagaaagtgcagaaggttatggtgcagcccatcaacctcatcttcagatacttacaaaatagatcgcggattcaggtgtggctctatgagcaagtgaatatgcggatagaaggctgtatcattggttttgatgagtatatgaaccttgtattagatgatgcagaagagattcattctaaaacaaagtcaagaaaacaactgggtcggatcatgctaaaaggagataatattactctgctacaaagtgtctccaactag
Sequence Length
279
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,804 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein polypeptide E, mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein polypeptide E
NCBI Official Symbol
SNRPE
NCBI Official Synonym Symbols
SME; Sm-E; HYPT11; snRNP-E
NCBI Protein Information
small nuclear ribonucleoprotein E
UniProt Protein Name
Small nuclear ribonucleoprotein E
UniProt Gene Name
SNRPE
UniProt Synonym Gene Names
snRNP-E; Sm-E; SmE
UniProt Entry Name
RUXE_HUMAN

NCBI Description

The protein encoded by this gene is a core component of U small nuclear ribonucleoproteins, which are key components of the pre-mRNA processing spliceosome. The encoded protein plays a role in the 3' end processing of histone transcripts. This protein is one of the targets in the autoimmune disease systemic lupus erythematosus, and mutations in this gene have been associated with hypotrichosis. Several pseudogenes of this gene have been identified. [provided by RefSeq, Jun 2016]

Uniprot Description

snRNP E: Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing. Associated with snRNP U1, U2, U4/U6 and U5. Belongs to the snRNP Sm proteins family.

Protein type: RNA splicing; Spliceosome

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: cytosol; nucleoplasm; nucleus; snRNP U1; snRNP U2; snRNP U5; telomerase holoenzyme complex; U12-dependent spliceosome; U4/U6 x U5 tri-snRNP complex

Molecular Function: protein binding

Biological Process: hair cycle; histone mRNA metabolic process; nuclear import; nuclear mRNA splicing, via spliceosome; spliceosomal snRNP biogenesis; termination of RNA polymerase II transcription

Disease: Hypotrichosis 11

Research Articles on SNRPE

Similar Products

Product Notes

The SNRPE snrpe (Catalog #AAA1271973) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtacc gtggccaggg tcagaaagtg cagaaggtta tggtgcagcc catcaacctc atcttcagat acttacaaaa tagatcgcgg attcaggtgt ggctctatga gcaagtgaat atgcggatag aaggctgtat cattggtttt gatgagtata tgaaccttgt attagatgat gcagaagaga ttcattctaa aacaaagtca agaaaacaac tgggtcggat catgctaaaa ggagataata ttactctgct acaaagtgtc tccaactag. It is sometimes possible for the material contained within the vial of "SNRPE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.