Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAF1 cdna clone

MAF1 cDNA Clone

Synonyms
MAF1; MAF1 cDNA Clone; MAF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctattggagaactcgagctttgaagccatcaactcacagctgactgtggagaccggagatgcccacatcattggcaggattgagagctactcatgtaagatggcaggagacgacaaacacatgttcaagcagttctgccaggagggccagccccacgtgctggaggcactttctccaccccagacttcaggactgagccccagcagactcagcaaaagccaaggcggtgaggaggagggccccctcagtgacaagtgcagccgcaagaccctcttctacctgattgccacgctcaatgagtccttcaggcctgactatgacttcagcacagcccgcagccatgagttcagccgggagcccagccttagctgggtggtgaatgcagtcaactgcagtctgttctcagctgtgcgggaggacttcaaggatctgaaaccacagctgtggaacgcggtggacgaggagatctgcctggctgaatgtgacatctacagctataacccagacttggactcagatcccttcggggaggatggtagcctctggtccttcaactacttcttctacaacaagcggctcaagcgaatcgtcttctttagctgccgttccatcagtggctccacctacacaccctcagaggcaggcaacgagctggacatggagctgggggaggaggaggtggaggaagaaagcagaagcaggggcagtggggccgaggagaccagcaccatggaggaggacagggtcccagtgatctgtatttga
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,771 Da
NCBI Official Full Name
Homo sapiens MAF1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
MAF1 homolog, negative regulator of RNA polymerase III
NCBI Official Symbol
MAF1
NCBI Protein Information
repressor of RNA polymerase III transcription MAF1 homolog
UniProt Protein Name
Repressor of RNA polymerase III transcription MAF1 homolog
Protein Family
UniProt Gene Name
MAF1
UniProt Entry Name
MAF1_HUMAN

NCBI Description

This gene encodes a protein that is similar to Maf1, a Saccharomyces cerevisiae protein highly conserved in eukaryotic cells. Yeast Maf1 is a negative effector of RNA polymerase III (Pol III). It responds to changes in the cellular environment and represses pol III transcription. Biochemical studies identified the initiation factor TFIIIB as a target for Maf1-dependent repression. [provided by RefSeq, Jul 2008]

Uniprot Description

MAF1: Element of the mTORC1 signaling pathway that acts as a mediator of diverse signals and that represses RNA polymerase III transcription. Inhibits the de novo assembly of TFIIIB onto DNA. Belongs to the MAF1 family.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: centrosome; cytoplasm; intracellular; intracellular membrane-bound organelle; nucleolus; nucleoplasm; nucleus

Biological Process: negative regulation of transcription from RNA polymerase III promoter

Research Articles on MAF1

Similar Products

Product Notes

The MAF1 maf1 (Catalog #AAA1271805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctat tggagaactc gagctttgaa gccatcaact cacagctgac tgtggagacc ggagatgccc acatcattgg caggattgag agctactcat gtaagatggc aggagacgac aaacacatgt tcaagcagtt ctgccaggag ggccagcccc acgtgctgga ggcactttct ccaccccaga cttcaggact gagccccagc agactcagca aaagccaagg cggtgaggag gagggccccc tcagtgacaa gtgcagccgc aagaccctct tctacctgat tgccacgctc aatgagtcct tcaggcctga ctatgacttc agcacagccc gcagccatga gttcagccgg gagcccagcc ttagctgggt ggtgaatgca gtcaactgca gtctgttctc agctgtgcgg gaggacttca aggatctgaa accacagctg tggaacgcgg tggacgagga gatctgcctg gctgaatgtg acatctacag ctataaccca gacttggact cagatccctt cggggaggat ggtagcctct ggtccttcaa ctacttcttc tacaacaagc ggctcaagcg aatcgtcttc tttagctgcc gttccatcag tggctccacc tacacaccct cagaggcagg caacgagctg gacatggagc tgggggagga ggaggtggag gaagaaagca gaagcagggg cagtggggcc gaggagacca gcaccatgga ggaggacagg gtcccagtga tctgtatttg a. It is sometimes possible for the material contained within the vial of "MAF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.