Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KDSR cdna clone

KDSR cDNA Clone

Synonyms
KDSR; KDSR cDNA Clone; KDSR cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgctggctgccgccttcctcgtggccttcgtgctgctgctgtacatggtgtctccgctcatcagccccaagcccctcgccctgcccggggcgcatgtggtggttacaggaggttccagtggcatcgggaagtgcattgctatcgagtgctataaacaaggagcttttataactctggttgcacgaaatgaggataagctgctgcaggcaaagaaagaaattgaaatgcactctattaatgacaaacaggtggtactttgcatatcagttgatgtatctcaagactataaccaagtagagaatgtcataaaacaagcacaggagaaactgggtccagtggacatgctggtaaattgtgcaggaatggcagtgtcaggaaaatttgaagatcttgaagttagtacctttgaaaggttaatgagcatcaattacctgggcagcgtgtaccccagccgggccgtgatcaccaccatgaaggagcgccgggtgggcaggatcgtgtttgtgtcctcccaggcaggacagttgggattattcggtttcacagcctactctgcatccaagtttgccataaggggattggcagaagctttgcagatggaggtgaagccatataatgtctacatcacagttgcttacccaccagacacagacacacctggctttgccgaagaaaacagaacaaagcctttggagactcgacttatttcagagaccacatctgtgtgcaaaccagaacaggtggccaaacaaattgttaaagatgccatacaaggaaatttcaacagttcccttggctcagatgggtacatgctctcggccctgacctgtgggatggctccagtaacttctattactgaggggctccagcaggtggtcaccatgggccttttccgcactattgctttgttttaccttggaagttttgacagcatagttcgtcgctgcatgatgcagagagaaaaatctgaaaatgcagacaaaactgcctaa
Sequence Length
999
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,159 Da
NCBI Official Full Name
Homo sapiens 3-ketodihydrosphingosine reductase, mRNA
UniProt Protein Name
3-ketodihydrosphingosine reductase
UniProt Gene Name
KDSR
UniProt Synonym Gene Names
FVT1; SDR35C1; KDS reductase; FVT-1
UniProt Entry Name
KDSR_HUMAN

Uniprot Description

FVT1: Catalyzes the reduction of 3-ketodihydrosphingosine (KDS) to dihydrosphingosine (DHS). A chromosomal aberration involving KDSR is a cause of follicular lymphoma; also known as type II chronic lymphatic leukemia. Translocation t(2;18)(p11;q21) with a Ig J kappa chain region. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Protein type: Oncoprotein; EC 1.1.1.102; Oxidoreductase; Membrane protein, integral; Membrane protein, multi-pass; Lipid Metabolism - sphingolipid

Chromosomal Location of Human Ortholog: 18q21.3

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; extracellular space; membrane

Molecular Function: 3-dehydrosphinganine reductase activity

Biological Process: 3-keto-sphinganine metabolic process; sphingolipid biosynthetic process

Similar Products

Product Notes

The KDSR kdsr (Catalog #AAA1271748) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc tggctgccgc cttcctcgtg gccttcgtgc tgctgctgta catggtgtct ccgctcatca gccccaagcc cctcgccctg cccggggcgc atgtggtggt tacaggaggt tccagtggca tcgggaagtg cattgctatc gagtgctata aacaaggagc ttttataact ctggttgcac gaaatgagga taagctgctg caggcaaaga aagaaattga aatgcactct attaatgaca aacaggtggt actttgcata tcagttgatg tatctcaaga ctataaccaa gtagagaatg tcataaaaca agcacaggag aaactgggtc cagtggacat gctggtaaat tgtgcaggaa tggcagtgtc aggaaaattt gaagatcttg aagttagtac ctttgaaagg ttaatgagca tcaattacct gggcagcgtg taccccagcc gggccgtgat caccaccatg aaggagcgcc gggtgggcag gatcgtgttt gtgtcctccc aggcaggaca gttgggatta ttcggtttca cagcctactc tgcatccaag tttgccataa ggggattggc agaagctttg cagatggagg tgaagccata taatgtctac atcacagttg cttacccacc agacacagac acacctggct ttgccgaaga aaacagaaca aagcctttgg agactcgact tatttcagag accacatctg tgtgcaaacc agaacaggtg gccaaacaaa ttgttaaaga tgccatacaa ggaaatttca acagttccct tggctcagat gggtacatgc tctcggccct gacctgtggg atggctccag taacttctat tactgagggg ctccagcagg tggtcaccat gggccttttc cgcactattg ctttgtttta ccttggaagt tttgacagca tagttcgtcg ctgcatgatg cagagagaaa aatctgaaaa tgcagacaaa actgcctaa. It is sometimes possible for the material contained within the vial of "KDSR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.