Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBA3 cdna clone

UBA3 cDNA Clone

Gene Names
UBA3; NAE2; UBE1C; hUBA3
Synonyms
UBA3; UBA3 cDNA Clone; UBA3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggatggcgaggagccggagaggaaaagaaggagaatagaggagctgctggctgagaaaatggctgttgatggtgggtgtggggacactggagactgggaaggtcgctggaaccatgtaaagaagttcctcgagcgatctggacccttcacacaccctgatttcgaaccgagcactgaatctctccagttcttgttagatacatgtaaagttctagtcattggagctggcggcttaggatgtgagctcctgaaaaatctggccttgtctggttttagacagattcatgttatagatatggacactatagatgtttccaatctaaataggcagtttttatttaggcctaaagatattggaagacctaaggctgaagttgctgcagaatttctaaatgacagagttcctaattgcaatgtagttccacatttcaacaagattcaagattttaacgacactttctatcgacaatttcatattattgtatgtggactggactctatcatcgccagaagatggataaatggcatgctgatatctcttctaaattatgaagatggtgtcttagatccaagctccattgtccctttgatagatggggggacagaaggttttaaaggaaatgcccgggtgattctgcctggaatgactgcttgtatcgaatgcacgctggaactttatccaccacaggttaattttcccatgtgcaccattgcatctatgcccaggctaccagaacactgtattgagtatgtaaggatgttgcagtggcctaaggagcagccttttggagaaggggttccattagatggagatgatcctgaacatatacaatggattttccaaaaatccctagagagagcatcacaatataatattaggggtgttacgtataggctcactcaaggggtagtaaaaagaatcattcctgcagtagcttccacaaatgcagtcattgcagctgtgtgtgccactgaggtttttaaaatagccacaagtgcatacattcccttgaataattacttggtgtttaatgatgtagatgggctgtatacatacacatttgaagcagaaagaaaggaaaactgcccagcttgtagccagcttcctcaaaatattcagttttctccatcagctaaactacaggaggttttggattatctaaccaatagtgcttctctgcaaatgaaatctccagccatcacagccaccctagagggaaaaaatagaacactttacttacagtcggtaacctctattgaagaacgaacaaggccaaatctctccaaaacattgaaagaattggggcttgttgatggacaagaactggcggttgctgatgtcaccaccccacagactgtactattcaaacttcattttacttcttaa
Sequence Length
1392
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,072 Da
NCBI Official Full Name
Homo sapiens ubiquitin-like modifier activating enzyme 3, mRNA
NCBI Official Synonym Full Names
ubiquitin like modifier activating enzyme 3
NCBI Official Symbol
UBA3
NCBI Official Synonym Symbols
NAE2; UBE1C; hUBA3
NCBI Protein Information
NEDD8-activating enzyme E1 catalytic subunit
UniProt Protein Name
NEDD8-activating enzyme E1 catalytic subunit
Protein Family
UniProt Gene Name
UBA3
UniProt Synonym Gene Names
UBE1C; Ubiquitin-activating enzyme 3
UniProt Entry Name
UBA3_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme associates with AppBp1, an amyloid beta precursor protein binding protein, to form a heterodimer, and then the enzyme complex activates NEDD8, a ubiquitin-like protein, which regulates cell division, signaling and embryogenesis. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

UBA3: Catalytic subunit of the dimeric UBA3-NAE1 E1 enzyme. E1 activates NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a NEDD8-UBA3 thioester and free AMP. E1 finally transfers NEDD8 to the catalytic cysteine of UBE2M. Down-regulates steroid receptor activity. Necessary for cell cycle progression. Belongs to the ubiquitin-activating E1 family. UBA3 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; EC 6.3.2.19; Ubiquitin conjugating system; Cell cycle regulation; EC 6.3.2.-; Ubiquitin ligase; Ligase

Chromosomal Location of Human Ortholog: 3p14.1

Cellular Component: cytosol; nucleus

Molecular Function: NEDD8 activating enzyme activity; protein binding; protein heterodimerization activity

Biological Process: protein modification process; protein neddylation; proteolysis

Research Articles on UBA3

Similar Products

Product Notes

The UBA3 uba3 (Catalog #AAA1271741) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatg gcgaggagcc ggagaggaaa agaaggagaa tagaggagct gctggctgag aaaatggctg ttgatggtgg gtgtggggac actggagact gggaaggtcg ctggaaccat gtaaagaagt tcctcgagcg atctggaccc ttcacacacc ctgatttcga accgagcact gaatctctcc agttcttgtt agatacatgt aaagttctag tcattggagc tggcggctta ggatgtgagc tcctgaaaaa tctggccttg tctggtttta gacagattca tgttatagat atggacacta tagatgtttc caatctaaat aggcagtttt tatttaggcc taaagatatt ggaagaccta aggctgaagt tgctgcagaa tttctaaatg acagagttcc taattgcaat gtagttccac atttcaacaa gattcaagat tttaacgaca ctttctatcg acaatttcat attattgtat gtggactgga ctctatcatc gccagaagat ggataaatgg catgctgata tctcttctaa attatgaaga tggtgtctta gatccaagct ccattgtccc tttgatagat ggggggacag aaggttttaa aggaaatgcc cgggtgattc tgcctggaat gactgcttgt atcgaatgca cgctggaact ttatccacca caggttaatt ttcccatgtg caccattgca tctatgccca ggctaccaga acactgtatt gagtatgtaa ggatgttgca gtggcctaag gagcagcctt ttggagaagg ggttccatta gatggagatg atcctgaaca tatacaatgg attttccaaa aatccctaga gagagcatca caatataata ttaggggtgt tacgtatagg ctcactcaag gggtagtaaa aagaatcatt cctgcagtag cttccacaaa tgcagtcatt gcagctgtgt gtgccactga ggtttttaaa atagccacaa gtgcatacat tcccttgaat aattacttgg tgtttaatga tgtagatggg ctgtatacat acacatttga agcagaaaga aaggaaaact gcccagcttg tagccagctt cctcaaaata ttcagttttc tccatcagct aaactacagg aggttttgga ttatctaacc aatagtgctt ctctgcaaat gaaatctcca gccatcacag ccaccctaga gggaaaaaat agaacacttt acttacagtc ggtaacctct attgaagaac gaacaaggcc aaatctctcc aaaacattga aagaattggg gcttgttgat ggacaagaac tggcggttgc tgatgtcacc accccacaga ctgtactatt caaacttcat tttacttctt aa. It is sometimes possible for the material contained within the vial of "UBA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.