Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNL2 cdna clone

CCNL2 cDNA Clone

Gene Names
CCNL2; CCNM; CCNS; PCEE; SB138; ANIA-6B; HLA-ISO; HCLA-ISO
Synonyms
CCNL2; CCNL2 cDNA Clone; CCNL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcggcggcggcggctggtgctgcagggtcggcagctcccgcggcagcggccggcgccccgggatctgggggcgcaccctcagggtcgcagggggtgctgatcggggacaggctgtactccggggtgctcatcaccttggagaactgcctcctgcctgacgacaagctccgtttcacgccgtccatgtcgagcggcctcgacagcgacacagagaccgacctccgcgtggtgggctgcgagctcatccaggcggccggtatcctgctccgcctgccgcaggtggccatggctaccgggcaggtgttgttccagcggttcttttataccaagtccttcgtgaagcactccatggagcatgtgtcaatggcctgtgtccacctggcttccaagatagaagaggccccaagacgcatacgggacgtcatcaatgtgtttcaccgccttcgacagctgagagacaaaaagaagcccgtgcctctactactggatcaagattatgttaatttaaagaaccaaattataaaggcggaaagacgagttctcaaagagttgggtttctgcgtccatgtgaagcatcctcataagataatcgttatgtaccttcaggtgttagagtgtgagcgtaaccaacacctggtccagacctcatgggtagcctctgagggtaagtga
Sequence Length
681
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,621 Da
NCBI Official Full Name
Homo sapiens cyclin L2, mRNA
NCBI Official Synonym Full Names
cyclin L2
NCBI Official Symbol
CCNL2
NCBI Official Synonym Symbols
CCNM; CCNS; PCEE; SB138; ANIA-6B; HLA-ISO; HCLA-ISO
NCBI Protein Information
cyclin-L2
UniProt Protein Name
Cyclin-L2
Protein Family
UniProt Gene Name
CCNL2
UniProt Entry Name
CCNL2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the cyclin family. Through its interaction with several proteins, such as RNA polymerase II, splicing factors, and cyclin-dependent kinases, this protein functions as a regulator of the pre-mRNA splicing process, as well as in inducing apoptosis by modulating the expression of apoptotic and antiapoptotic proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

CCNL2: Transcriptional regulator which participates in regulating the pre-mRNA splicing process. Also modulates the expression of critical apoptotic factor, leading to cell apoptosis. Belongs to the cyclin family. Cyclin L subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription regulation; Cell cycle regulation

Chromosomal Location of Human Ortholog: 1p36.33

Cellular Component: cyclin-dependent protein kinase holoenzyme complex; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: cyclin-dependent protein kinase regulator activity; protein binding

Biological Process: positive regulation of cyclin-dependent protein kinase activity; positive regulation of transcription from RNA polymerase II promoter

Research Articles on CCNL2

Similar Products

Product Notes

The CCNL2 ccnl2 (Catalog #AAA1271692) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cggcggcggc ggctggtgct gcagggtcgg cagctcccgc ggcagcggcc ggcgccccgg gatctggggg cgcaccctca gggtcgcagg gggtgctgat cggggacagg ctgtactccg gggtgctcat caccttggag aactgcctcc tgcctgacga caagctccgt ttcacgccgt ccatgtcgag cggcctcgac agcgacacag agaccgacct ccgcgtggtg ggctgcgagc tcatccaggc ggccggtatc ctgctccgcc tgccgcaggt ggccatggct accgggcagg tgttgttcca gcggttcttt tataccaagt ccttcgtgaa gcactccatg gagcatgtgt caatggcctg tgtccacctg gcttccaaga tagaagaggc cccaagacgc atacgggacg tcatcaatgt gtttcaccgc cttcgacagc tgagagacaa aaagaagccc gtgcctctac tactggatca agattatgtt aatttaaaga accaaattat aaaggcggaa agacgagttc tcaaagagtt gggtttctgc gtccatgtga agcatcctca taagataatc gttatgtacc ttcaggtgtt agagtgtgag cgtaaccaac acctggtcca gacctcatgg gtagcctctg agggtaagtg a. It is sometimes possible for the material contained within the vial of "CCNL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.