Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GRIN2C cdna clone

GRIN2C cDNA Clone

Gene Names
GRIN2C; NR2C; GluN2C; NMDAR2C
Synonyms
GRIN2C; GRIN2C cDNA Clone; GRIN2C cdna clone
Ordering
For Research Use Only!
Sequence
atgggtggggccctggggccggccctgttgctcacctcgctcttcggtgcctgggcagggctgggtccggggcagggcgagcagggcatgacggtggccgtggtgtttagcagctcagggccgccccaggcccagttccgtgcccgcctcaccccccagagcttcctggacctacccctggagatccagccgctcacagttggggtcaacaccaccaaccccagcagcctcctcacccagatctgcggcctcctgggtgctgcccacgtccacggcattgtctttgaggacaacgtggacaccgaggcggtggcccagatccttgacttcatctcctcccagacccatgtgcccatcctcagcatcagcggaggctctgctgtggtcctcacccccaaggtgcatgtccaaactcatgtcccctcgtgcctcaggcctggaaccaggctggggtcgggggtgctttggttctgggaagctgggattagacgggatgggcagggaggtgggggctga
Sequence Length
516
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
134,209 Da
NCBI Official Full Name
Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C, mRNA
NCBI Official Synonym Full Names
glutamate ionotropic receptor NMDA type subunit 2C
NCBI Official Symbol
GRIN2C
NCBI Official Synonym Symbols
NR2C; GluN2C; NMDAR2C
NCBI Protein Information
glutamate receptor ionotropic, NMDA 2C
UniProt Protein Name
Glutamate receptor ionotropic, NMDA 2C
UniProt Gene Name
GRIN2C
UniProt Synonym Gene Names
NMDAR2C; GluN2C; NMDAR2C; NR2C
UniProt Entry Name
NMDE3_HUMAN

NCBI Description

This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

NMDAR2C: NMDA receptor subtype of glutamate-gated ion channels with high calcium permeability and voltage-dependent sensitivity to magnesium. Mediated by glycine. Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family. NR2C/GRIN2C subfamily.

Protein type: Channel, ligand-gated; Channel, calcium; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q25.1

Cellular Component: integral to plasma membrane; N-methyl-D-aspartate selective glutamate receptor complex; plasma membrane

Molecular Function: protein binding; Ras guanyl-nucleotide exchange factor activity

Biological Process: glutamate signaling pathway; MAPKKK cascade; synaptic transmission; transport

Research Articles on GRIN2C

Similar Products

Product Notes

The GRIN2C grin2c (Catalog #AAA1271507) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgggg ccctggggcc ggccctgttg ctcacctcgc tcttcggtgc ctgggcaggg ctgggtccgg ggcagggcga gcagggcatg acggtggccg tggtgtttag cagctcaggg ccgccccagg cccagttccg tgcccgcctc accccccaga gcttcctgga cctacccctg gagatccagc cgctcacagt tggggtcaac accaccaacc ccagcagcct cctcacccag atctgcggcc tcctgggtgc tgcccacgtc cacggcattg tctttgagga caacgtggac accgaggcgg tggcccagat ccttgacttc atctcctccc agacccatgt gcccatcctc agcatcagcg gaggctctgc tgtggtcctc acccccaagg tgcatgtcca aactcatgtc ccctcgtgcc tcaggcctgg aaccaggctg gggtcggggg tgctttggtt ctgggaagct gggattagac gggatgggca gggaggtggg ggctga. It is sometimes possible for the material contained within the vial of "GRIN2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.