Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2J1 cdna clone

UBE2J1 cDNA Clone

Gene Names
UBE2J1; UBC6; UBC6E; Ubc6p; CGI-76; NCUBE1; HSPC153; HSPC205; NCUBE-1; HSU93243
Synonyms
UBE2J1; UBE2J1 cDNA Clone; UBE2J1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacccgctacaacctgaagagtccggctgttaaacgtttaatgaaagaagcggcagaattgaaagatccaacagatcattaccatgcgcagcctttagaggataacctttttgaatggcacttcacggttagagggcccccagactccgattttgatggaggagtttatcacgggcggatagtactgccaccagagtatcccatgaaaccaccaagcattattctcctaacggctaatggtcgatttgaagtgggcaagaaaatctgtttgagcatctcaggccatcatcctgaaacttggcagccttcgtggagtataaggacagcattattagccatcattgggtttatgccaacaaaaggagagggagccataggttctctagattacactcctgaggaaagaagagcacttgccaaaaaatcacaagatttctgttgtgaaggatgtggctctgccatgaaggatgtcctgttgcctttaaaatctggaagcgattcaagccaagctgaccaagaagccaaagaactggctaggcaaataagctttaaggcagaagtcaattcatctggaaagactatctctgagtcagacttaaaccactctttttcactaactgatttacaagatgatatacctacaacattccagggtgctacggccagtacatcgtacggagtccagaattcctcagcagcatcctttcatcaacctacccaacctgtagctaagaatacctccatgagccctcgacagcgccgggcccagcagcagagtcagagaaggttgtctacttcaccagatgtaatccagggccaccagccaagagacaaccacactgatcatggtgggtcagctgtactgattgtcatcctgactttggcattggcagctcttatattccgacgaatatatctggcaaacgaatacatatttgactttgagttataa
Sequence Length
957
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,199 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 J1
NCBI Official Symbol
UBE2J1
NCBI Official Synonym Symbols
UBC6; UBC6E; Ubc6p; CGI-76; NCUBE1; HSPC153; HSPC205; NCUBE-1; HSU93243
NCBI Protein Information
ubiquitin-conjugating enzyme E2 J1
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 J1
UniProt Gene Name
UBE2J1
UniProt Synonym Gene Names
NCUBE1; NCUBE-1; HsUBC6e
UniProt Entry Name
UB2J1_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum (ER) and may contribute to quality control ER-associated degradation by the ubiquitin-proteasome system. [provided by RefSeq, Jul 2008]

Uniprot Description

UBE2J1: Catalyzes the covalent attachment of ubiquitin to other proteins. Functions in the selective degradation of misfolded membrane proteins from the endoplasmic reticulum (ERAD). Belongs to the ubiquitin-conjugating enzyme family.

Protein type: Membrane protein, integral; Ubiquitin conjugating system; Ligase; Ubiquitin ligase; EC 6.3.2.19

Chromosomal Location of Human Ortholog: 6q15

Cellular Component: cytoplasm

Molecular Function: ubiquitin protein ligase binding

Biological Process: ER-associated protein catabolic process; protein amino acid N-linked glycosylation via asparagine

Research Articles on UBE2J1

Similar Products

Product Notes

The UBE2J1 ube2j1 (Catalog #AAA1271475) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaccc gctacaacct gaagagtccg gctgttaaac gtttaatgaa agaagcggca gaattgaaag atccaacaga tcattaccat gcgcagcctt tagaggataa cctttttgaa tggcacttca cggttagagg gcccccagac tccgattttg atggaggagt ttatcacggg cggatagtac tgccaccaga gtatcccatg aaaccaccaa gcattattct cctaacggct aatggtcgat ttgaagtggg caagaaaatc tgtttgagca tctcaggcca tcatcctgaa acttggcagc cttcgtggag tataaggaca gcattattag ccatcattgg gtttatgcca acaaaaggag agggagccat aggttctcta gattacactc ctgaggaaag aagagcactt gccaaaaaat cacaagattt ctgttgtgaa ggatgtggct ctgccatgaa ggatgtcctg ttgcctttaa aatctggaag cgattcaagc caagctgacc aagaagccaa agaactggct aggcaaataa gctttaaggc agaagtcaat tcatctggaa agactatctc tgagtcagac ttaaaccact ctttttcact aactgattta caagatgata tacctacaac attccagggt gctacggcca gtacatcgta cggagtccag aattcctcag cagcatcctt tcatcaacct acccaacctg tagctaagaa tacctccatg agccctcgac agcgccgggc ccagcagcag agtcagagaa ggttgtctac ttcaccagat gtaatccagg gccaccagcc aagagacaac cacactgatc atggtgggtc agctgtactg attgtcatcc tgactttggc attggcagct cttatattcc gacgaatata tctggcaaac gaatacatat ttgactttga gttataa. It is sometimes possible for the material contained within the vial of "UBE2J1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.