PRDX5 cdna clone

PRDX5 cDNA Clone

Cat. Num. AAA1271357

• Gene Names: PRDX5; PLP; ACR1; B166; PRXV; PMP20; PRDX6; prx-V; SBBI10; AOEB166; HEL-S-55
• Synonyms: PRDX5; PRDX5 cDNA Clone; PRDX5 cdna clone

• Sequence: atgggactagctggcgtgtgcgccctgagacgctcagcgggctatatactcgtcggtggggccggcggtcagtctgcggcagcggcagcaagacggtgcagtgaaggagagtgggcgtctggcggggtccgcagtttcagcagagccgctgcagccatggccccaatcaaggtgggagatgccatcccagcagtggaggtgtttgaaggggagccagggaacaaggtgaacctggcagagctgttcaagggcaagaagggtgtgctgtttggagttcctggggccttcacccctggatgttccaagacacacctgccagggtttgtggagcaggctgaggctctgaaggccaagggagtccaggtggtggcctgtctgagtgttaatgatgcctttgtgactggcgagtggggccgagcccacaaggcggaaggcaaggttcggctcctggctgatcccactggggcctttgggaaggagacagacttattactagatgattcgctggtgtccatctttgggaatcgacgtctcaagaggttctccatggtggtacaggatggcatagtgaaggccctgaatgtggaaccagatggcacaggcctcacctgcagcctggcacccaatatcatctcacagctctga
• Sequence Length: 645

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 109731384
• NCBI GeneID: 25824
• Molecular Weight: 12,897 Da
• NCBI Official Full Name: Homo sapiens peroxiredoxin 5, mRNA
• NCBI Official Synonym Full Names: peroxiredoxin 5
• NCBI Official Symbol: PRDX5
• NCBI Official Synonym Symbols: PLP; ACR1; B166; PRXV; PMP20; PRDX6; prx-V; SBBI10; AOEB166; HEL-S-55
• NCBI Protein Information: peroxiredoxin-5, mitochondrial
• UniProt Protein Name: Peroxiredoxin-5, mitochondrial
• Protein Family: Peroxiredoxin
• UniProt Gene Name: PRDX5
• UniProt Synonym Gene Names: ACR1; AOEB166; Prx-V
• UniProt Entry Name: PRDX5_HUMAN

NCBI Description

This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PRDX5: Reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Involved in intracellular redox signaling. Belongs to the peroxiredoxin 2 family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: EC 1.11.1.15; Oxidoreductase

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytoplasm; cytoplasmic vesicle; cytosol; extracellular space; intracellular membrane-bound organelle; mitochondrial matrix; mitochondrion; nucleus; perinuclear region of cytoplasm; peroxisome

Molecular Function: caspase inhibitor activity; peroxidase activity; protein dimerization activity; receptor binding; thioredoxin peroxidase activity

Biological Process: inflammatory response; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase III promoter; response to oxidative stress; response to reactive oxygen species