Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

USO1 cdna clone

USO1 cDNA Clone

Gene Names
USO1; TAP; VDP; P115
Synonyms
USO1; USO1 cDNA Clone; USO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatttcctccgcggggtaatggggggtcagagtgccggaccccagcacacagaagccgagacgattcaaaagctttgtgacagagtagcttcatctactttattggatgatcgaagaaatgctgttcgtgctctcaaatcattatctaagaaataccgcttggaagtgggtatacaagctatggaacatcttattcatgttttacaaacagatcgttcagattctgaaataataggttatgctttggacacactatataatataatatctaatgaagaagaagaagtagaagaaaattccacaagacagagtgaagatttgggaagccaatttacagaaattttcattaagcagcaggaaaatgtcactcttctgttatctttattggaggagtttgatttccatgtccgctggcctggtgtgaagcttcttacttctcttttaaaacaactagggcctcaggtgcaacaaattattttagtcagtcctatgggtgtttcaagattgatggacttactagcggattccagggaagttatacgtaatgatggcgtcttactactgcaggcactaacaagaagcaatggtgcaatccagaaaattgttgcttttgaaaatgctttcgagagactactggacattatttcagaggaggggaacagtgatggaggtatagtagttgaagattgtttgattttgctccaaaacttattaaaaaacaacaactccaatcaaaatttttttaaagaaggctcatatattcaacgtatgaaaccttggtttgaagttggagatgaaaattctggctggtctgcacagaaagtgaccaatctacatctaatgctacagcttgttcgtgtattggtatctcccaccaaccctcctggtgctaccagtagctgccagaaggctatgttccagtgtgggttattgcagcagctttgtactatcctaatggctactggggttcctgctgatatcctgactgagaccataaatactgtatcagaagttattcgaggctgccaagtaaaccaagactactttgcatctgtaaatgcaccttcaaacccaccaagaccggcaattgtagtacttctcatgtccatggttaatgaaaggcagccatttgttttgcgctgtgctgttctctattgtttccagtgtttcttgtataaaaaccaaaaaggacaaggagaaatcgtgtcaacacttttaccttctaccattgatgcaacaggtaattcagtttcagctggccagttattatgtggaggtttgttttctactgattcactttcaaactggtgtgctgctgtggcccttgcccatgcgttgcaagaaaatgccacccagaaagaacagttgctcagggttcaacttgctacaagtattggcaaccctccagtttctttacttcaacagtgcaccaatattctttcacagggaagcaaaatacaaacaagagttggattattaatgttgctttgtacctggctaagcaattgtcccattgcagtaacgcattttcttcacaattcagccaatgttccattccttacaggacaaattgcagaaaatcttggagaagaagagcagttggtccaaggcttatgtgcccttttgttgggcatttcgatttatttcaatgataactcacttgagagctacatgaaagagaagctaaaacaactgattgagaagaggattggcaaagagaatttcatagagaaactaggatttattagcaaacatgagttgtattccagagcatctcagaaaccccagccaaactttcccagtccagaatacatgatatttgatcatgagtttacgaagctggtaaaagaacttgaaggtgttataactaaggctatttataagtccagtgaagaagataaaaaagaagaagaggtgaaaaaaacattagaacagcatgacaatattgtgactcactacaaaaatatgattcgagagcaagatctccaacttgaggaattaaggcagcaggtttctacattaaaatgtcaaaatgaacagctccagacggcagtcacacagcaagtatcacagatccagcagcacaaagaccagtataatcttcttaaaatacagctaggaaaagacaatcagcatcaaggttcttacagtgagggggctcagatgaatggcattcagccagaagaaattggtagattgcgagaagagatagaagaattaaaacgtaatcaggaacttttacaaagccagctgactgaaaaggactctatgattgaaaatatgaaatcttcccaaacatctggcacaaatgaacagtcttcagcaatagtttcagctagagattctgaacaagttgcagaattaaaacaggaactggcaactttaaagtctcagttaaactcacaatctgtggagatcaccaaactacagacagaaaagcaggaactgttacagaaaacagaagcgtttgcaaaatcagttgaggtacaaggagagaccgagactataatagccaccaaaactactgatgtagaaggaagactgtcagcattattacaagagaccaaagagttaaagaatgaaattaaagctctgtctgaggaaagaactgccattaaagagcagctggattcatctaatagtaccattgccattttacaaactgagaaagacaaactagagttggaaattacagattctaaaaaagaacaagatgatctcttggtgctcttggccgatcaagatcagaaaatactgtcattgaagaataaactcaaggatcttggtcatccagttgaagaagaggatgaacttgaatctggagaccaagaggatgaggatgatgaaagtgaagatcctggcaaggatctagatcatatctag
Sequence Length
2886
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
109,195 Da
NCBI Official Full Name
Homo sapiens USO1 homolog, vesicle docking protein (yeast), mRNA
NCBI Official Synonym Full Names
USO1 vesicle transport factor
NCBI Official Symbol
USO1
NCBI Official Synonym Symbols
TAP; VDP; P115
NCBI Protein Information
general vesicular transport factor p115
UniProt Protein Name
General vesicular transport factor p115
UniProt Gene Name
USO1
UniProt Synonym Gene Names
VDP; TAP
UniProt Entry Name
USO1_HUMAN

NCBI Description

The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

Uniprot Description

TAP: General vesicular transport factor required for intercisternal transport in the Golgi stack; it is required for transcytotic fusion and/or subsequent binding of the vesicles to the target membrane. May well act as a vesicular anchor by interacting with the target membrane and holding the vesicular and target membranes in proximity. Belongs to the VDP/USO1/EDE1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 4q21.1

Cellular Component: cell-cell adherens junction; cytosol; endoplasmic reticulum; Golgi apparatus; Golgi membrane; Golgi stack; membrane; nucleolus; transport vesicle

Molecular Function: protein binding; protein transporter activity

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; Golgi vesicle docking; intracellular protein transport; transcytosis

Research Articles on USO1

Similar Products

Product Notes

The USO1 uso1 (Catalog #AAA1271322) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatttcc tccgcggggt aatggggggt cagagtgccg gaccccagca cacagaagcc gagacgattc aaaagctttg tgacagagta gcttcatcta ctttattgga tgatcgaaga aatgctgttc gtgctctcaa atcattatct aagaaatacc gcttggaagt gggtatacaa gctatggaac atcttattca tgttttacaa acagatcgtt cagattctga aataataggt tatgctttgg acacactata taatataata tctaatgaag aagaagaagt agaagaaaat tccacaagac agagtgaaga tttgggaagc caatttacag aaattttcat taagcagcag gaaaatgtca ctcttctgtt atctttattg gaggagtttg atttccatgt ccgctggcct ggtgtgaagc ttcttacttc tcttttaaaa caactagggc ctcaggtgca acaaattatt ttagtcagtc ctatgggtgt ttcaagattg atggacttac tagcggattc cagggaagtt atacgtaatg atggcgtctt actactgcag gcactaacaa gaagcaatgg tgcaatccag aaaattgttg cttttgaaaa tgctttcgag agactactgg acattatttc agaggagggg aacagtgatg gaggtatagt agttgaagat tgtttgattt tgctccaaaa cttattaaaa aacaacaact ccaatcaaaa tttttttaaa gaaggctcat atattcaacg tatgaaacct tggtttgaag ttggagatga aaattctggc tggtctgcac agaaagtgac caatctacat ctaatgctac agcttgttcg tgtattggta tctcccacca accctcctgg tgctaccagt agctgccaga aggctatgtt ccagtgtggg ttattgcagc agctttgtac tatcctaatg gctactgggg ttcctgctga tatcctgact gagaccataa atactgtatc agaagttatt cgaggctgcc aagtaaacca agactacttt gcatctgtaa atgcaccttc aaacccacca agaccggcaa ttgtagtact tctcatgtcc atggttaatg aaaggcagcc atttgttttg cgctgtgctg ttctctattg tttccagtgt ttcttgtata aaaaccaaaa aggacaagga gaaatcgtgt caacactttt accttctacc attgatgcaa caggtaattc agtttcagct ggccagttat tatgtggagg tttgttttct actgattcac tttcaaactg gtgtgctgct gtggcccttg cccatgcgtt gcaagaaaat gccacccaga aagaacagtt gctcagggtt caacttgcta caagtattgg caaccctcca gtttctttac ttcaacagtg caccaatatt ctttcacagg gaagcaaaat acaaacaaga gttggattat taatgttgct ttgtacctgg ctaagcaatt gtcccattgc agtaacgcat tttcttcaca attcagccaa tgttccattc cttacaggac aaattgcaga aaatcttgga gaagaagagc agttggtcca aggcttatgt gcccttttgt tgggcatttc gatttatttc aatgataact cacttgagag ctacatgaaa gagaagctaa aacaactgat tgagaagagg attggcaaag agaatttcat agagaaacta ggatttatta gcaaacatga gttgtattcc agagcatctc agaaacccca gccaaacttt cccagtccag aatacatgat atttgatcat gagtttacga agctggtaaa agaacttgaa ggtgttataa ctaaggctat ttataagtcc agtgaagaag ataaaaaaga agaagaggtg aaaaaaacat tagaacagca tgacaatatt gtgactcact acaaaaatat gattcgagag caagatctcc aacttgagga attaaggcag caggtttcta cattaaaatg tcaaaatgaa cagctccaga cggcagtcac acagcaagta tcacagatcc agcagcacaa agaccagtat aatcttctta aaatacagct aggaaaagac aatcagcatc aaggttctta cagtgagggg gctcagatga atggcattca gccagaagaa attggtagat tgcgagaaga gatagaagaa ttaaaacgta atcaggaact tttacaaagc cagctgactg aaaaggactc tatgattgaa aatatgaaat cttcccaaac atctggcaca aatgaacagt cttcagcaat agtttcagct agagattctg aacaagttgc agaattaaaa caggaactgg caactttaaa gtctcagtta aactcacaat ctgtggagat caccaaacta cagacagaaa agcaggaact gttacagaaa acagaagcgt ttgcaaaatc agttgaggta caaggagaga ccgagactat aatagccacc aaaactactg atgtagaagg aagactgtca gcattattac aagagaccaa agagttaaag aatgaaatta aagctctgtc tgaggaaaga actgccatta aagagcagct ggattcatct aatagtacca ttgccatttt acaaactgag aaagacaaac tagagttgga aattacagat tctaaaaaag aacaagatga tctcttggtg ctcttggccg atcaagatca gaaaatactg tcattgaaga ataaactcaa ggatcttggt catccagttg aagaagagga tgaacttgaa tctggagacc aagaggatga ggatgatgaa agtgaagatc ctggcaagga tctagatcat atctag. It is sometimes possible for the material contained within the vial of "USO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.