Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SAMM50 cdna clone

SAMM50 cDNA Clone

Gene Names
SAMM50; OMP85; SAM50; TOB55; TRG-3; CGI-51; YNL026W
Synonyms
SAMM50; SAMM50 cDNA Clone; SAMM50 cdna clone
Ordering
For Research Use Only!
Sequence
atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggactaaagatgatatcatcatttgtgaaattggagatgttttcaaggccaaaaacctaattgaggtaatgcggaaatctcatgaagcccgtgaaaaattgctccgtcttggaatttttagacaagtggatgttttgattgacacatgtcaaggtgatgacgcacttccaaatgggttagacgttacctttgaagtaactgaattgaggagattaacgggcagttataacaccatggttgggaacaatgaaggcagtatggtacttggcctcaagcttcctaatcttcttggtcgtgcagaaaaggtgacctttcagttttcctatggaacaaaagaaacttcgtatggcctgtccttcttcaaaccacggcccggaaacttcgaaagaaatttctctgtaaacttatataaagttactggacagttcccttggagctcactgcgggagacggacagaggaatgtcagctgagtacagttttcccatatggaagaccagccacactgtcaagtgggaaggcgtatggcgagaactgggctgcctctcaaggacggcgtcatttgctgttcgaaaagaaagcggacattcactgaaatcatctctttcgcacgccatggtcatcgattctcggaattcttccatcttaccaaggagaggtgctttgctgaaagttaaccaggaactggcaggctacactggcggggatgtgagcttcatcaaagaagattttgaacttcagttgaacaagcaactcatatttgattcagttttttcagcgtctttctggggcggaatgttggtacccattggtgataagccgtcaagcattgctgataggttttacctcgggggacccacaagcgtccgcggattcagcatgcacagcatcgggccacagagcgaaggagactacctaggtggagaagcgtactgggccggcggcctgcacctctacaccccattacctttccggccaggccagggtggctttggagaacttttccgaacacacttctttctcaacgcaggaaacctctgcaacctcaactatggggagggccccaaagctcatattcgtaagctggctgagtgcatccgctggtcgtacggggccgggattgtcctcaggcttggcaacatcgctcggttggaacttaattactgcgtccccatgggagtacagacaggtgacaggatatgtgatggcgtccagtttggagctgggataaggttcctgtag
Sequence Length
1410
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,976 Da
NCBI Official Full Name
Homo sapiens sorting and assembly machinery component 50 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SAMM50 sorting and assembly machinery component
NCBI Official Symbol
SAMM50
NCBI Official Synonym Symbols
OMP85; SAM50; TOB55; TRG-3; CGI-51; YNL026W
NCBI Protein Information
sorting and assembly machinery component 50 homolog
UniProt Protein Name
Sorting and assembly machinery component 50 homolog
UniProt Gene Name
SAMM50
UniProt Synonym Gene Names
SAM50; TRG-3
UniProt Entry Name
SAM50_HUMAN

NCBI Description

This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]

Uniprot Description

SAMM50: May be required for the assembly pathway of mitochondrial outer membrane proteins. Belongs to the SAM50/omp85 family.

Protein type: Membrane protein, multi-pass; Mitochondrial

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: integral to membrane; mitochondrial outer membrane; mitochondrion

Molecular Function: protein binding

Biological Process: cristae formation; mitochondrial respiratory chain complex assembly; protein import into mitochondrial outer membrane

Research Articles on SAMM50

Similar Products

Product Notes

The SAMM50 samm50 (Catalog #AAA1271292) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggactg tgcacgcccg gagtttggag cctcttccat caagtggacc tgattttgga ggattaggag aagaagctga atttgttgaa gttgagcctg aagctaaaca ggaaattctt gaaaacaaag atgtggttgt tcaacatgtt cattttgatg gacttggaag gactaaagat gatatcatca tttgtgaaat tggagatgtt ttcaaggcca aaaacctaat tgaggtaatg cggaaatctc atgaagcccg tgaaaaattg ctccgtcttg gaatttttag acaagtggat gttttgattg acacatgtca aggtgatgac gcacttccaa atgggttaga cgttaccttt gaagtaactg aattgaggag attaacgggc agttataaca ccatggttgg gaacaatgaa ggcagtatgg tacttggcct caagcttcct aatcttcttg gtcgtgcaga aaaggtgacc tttcagtttt cctatggaac aaaagaaact tcgtatggcc tgtccttctt caaaccacgg cccggaaact tcgaaagaaa tttctctgta aacttatata aagttactgg acagttccct tggagctcac tgcgggagac ggacagagga atgtcagctg agtacagttt tcccatatgg aagaccagcc acactgtcaa gtgggaaggc gtatggcgag aactgggctg cctctcaagg acggcgtcat ttgctgttcg aaaagaaagc ggacattcac tgaaatcatc tctttcgcac gccatggtca tcgattctcg gaattcttcc atcttaccaa ggagaggtgc tttgctgaaa gttaaccagg aactggcagg ctacactggc ggggatgtga gcttcatcaa agaagatttt gaacttcagt tgaacaagca actcatattt gattcagttt tttcagcgtc tttctggggc ggaatgttgg tacccattgg tgataagccg tcaagcattg ctgataggtt ttacctcggg ggacccacaa gcgtccgcgg attcagcatg cacagcatcg ggccacagag cgaaggagac tacctaggtg gagaagcgta ctgggccggc ggcctgcacc tctacacccc attacctttc cggccaggcc agggtggctt tggagaactt ttccgaacac acttctttct caacgcagga aacctctgca acctcaacta tggggagggc cccaaagctc atattcgtaa gctggctgag tgcatccgct ggtcgtacgg ggccgggatt gtcctcaggc ttggcaacat cgctcggttg gaacttaatt actgcgtccc catgggagta cagacaggtg acaggatatg tgatggcgtc cagtttggag ctgggataag gttcctgtag. It is sometimes possible for the material contained within the vial of "SAMM50, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.