Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAH cdna clone

FAH cDNA Clone

Synonyms
FAH; FAH cDNA Clone; FAH cdna clone
Ordering
For Research Use Only!
Sequence
atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacaccaggatgtcttcaatcagcctacactcaacagcttcatgggcctgggtcaggctgcctggaaggaggcgagagtgttcttgcagaacttgctgtctgtgagccaagccaggctcagagatgacaccgaacttcggaagtgtgcattcatctcccaggcttctgccacgatgcaccttccagccaccataggagactacacagacttctattcctctcggcagcatgctaccaacgtcggaatcatgttcagggacaaggagaatgcgttgatgccaaattggctgcacttaccagtgggctaccatggccgtgcctcctctgtcgtggtgtctggcaccccaatccgaaggcccatgggacagatgaaacctgatgactctaagcctcccgtatatggtgcctgcaagctcttggacatggagctggaaatggctttttttgtaggccctggaaacagattgggagagccgatccccatttccaaggcccatgagcacatttttggaatggtccttatgaacgactggagtgcacgagacattcagaagtgggagtatgtccctctcgggccattccttgggaagagttttgggaccactgtctctccgtgggtggtgcccatggatgctctcatgccctttgctgtgcccaacccgaagcaggaccccaggcccctgccgtatctgtgccatgacgagccctacacatttgacatcaacctctctgttaacctgaaaggagaaggaatgagccaggcggctaccatatgcaagtccaattttaagtacatgtactggacgatgctgcagcagctcactcaccactctgtcaacggctgcaacctgcggccgggggacctcctggcttctgggaccatcagcgggccggagccagaaaacttcggctccatgttggaactgtcgtggaagggaacgaagcccatagacctggggaatggtcagaccaggaagtttctgctggacggggatgaagtcatcataacagggtactgccagggggatggttaccgcatcggctttggccagtgtgctggaaaagtgctgcctgctctcctgccatcatga
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,614 Da
NCBI Official Full Name
Homo sapiens fumarylacetoacetate hydrolase (fumarylacetoacetase), mRNA
NCBI Official Synonym Full Names
fumarylacetoacetate hydrolase
NCBI Official Symbol
FAH
NCBI Protein Information
fumarylacetoacetase
UniProt Protein Name
Fumarylacetoacetase
Protein Family
UniProt Gene Name
FAH
UniProt Synonym Gene Names
FAA
UniProt Entry Name
FAAA_HUMAN

NCBI Description

This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]

Uniprot Description

FAH: Defects in FAH are the cause of tyrosinemia type 1 (TYRO1). An inborn error of metabolism characterized by elevations of tyrosine in the blood and urine, and hepatorenal manifestations. Typical features include hepatic necrosis, renal tubular injury, episodic weakness, self-mutilation, and seizures. Renal tubular dysfunction is associated with phosphate loss and hypophosphataemic rickets. Progressive liver disease can lead to the development of hepatocellular carcinoma. Dietary treatment with restriction of tyrosine and phenylalanine alleviates the rickets, but liver transplantation has so far been the only definite treatment. Belongs to the FAH family.

Protein type: Hydrolase; Amino Acid Metabolism - tyrosine; EC 3.7.1.2

Chromosomal Location of Human Ortholog: 15q25.1

Cellular Component: cytosol

Molecular Function: fumarylacetoacetase activity; protein binding

Biological Process: L-phenylalanine catabolic process

Disease: Tyrosinemia, Type I

Research Articles on FAH

Similar Products

Product Notes

The FAH fah (Catalog #AAA1271181) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccttca tcccggtggc cgaggattcc gacttcccca tccacaacct gccctacggc gtcttctcga ccagaggcga cccaagaccg aggataggtg tggccattgg cgaccagatc ctggacctca gcatcatcaa gcacctcttt actggtcctg tcctctccaa acaccaggat gtcttcaatc agcctacact caacagcttc atgggcctgg gtcaggctgc ctggaaggag gcgagagtgt tcttgcagaa cttgctgtct gtgagccaag ccaggctcag agatgacacc gaacttcgga agtgtgcatt catctcccag gcttctgcca cgatgcacct tccagccacc ataggagact acacagactt ctattcctct cggcagcatg ctaccaacgt cggaatcatg ttcagggaca aggagaatgc gttgatgcca aattggctgc acttaccagt gggctaccat ggccgtgcct cctctgtcgt ggtgtctggc accccaatcc gaaggcccat gggacagatg aaacctgatg actctaagcc tcccgtatat ggtgcctgca agctcttgga catggagctg gaaatggctt tttttgtagg ccctggaaac agattgggag agccgatccc catttccaag gcccatgagc acatttttgg aatggtcctt atgaacgact ggagtgcacg agacattcag aagtgggagt atgtccctct cgggccattc cttgggaaga gttttgggac cactgtctct ccgtgggtgg tgcccatgga tgctctcatg ccctttgctg tgcccaaccc gaagcaggac cccaggcccc tgccgtatct gtgccatgac gagccctaca catttgacat caacctctct gttaacctga aaggagaagg aatgagccag gcggctacca tatgcaagtc caattttaag tacatgtact ggacgatgct gcagcagctc actcaccact ctgtcaacgg ctgcaacctg cggccggggg acctcctggc ttctgggacc atcagcgggc cggagccaga aaacttcggc tccatgttgg aactgtcgtg gaagggaacg aagcccatag acctggggaa tggtcagacc aggaagtttc tgctggacgg ggatgaagtc atcataacag ggtactgcca gggggatggt taccgcatcg gctttggcca gtgtgctgga aaagtgctgc ctgctctcct gccatcatga. It is sometimes possible for the material contained within the vial of "FAH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.