TUBB2B cdna clone
TUBB2B cDNA Clone
Gene Names
TUBB2B; PMGYSA; bA506K6.1
Synonyms
TUBB2B; TUBB2B cDNA Clone; TUBB2B cdna clone
Sequence
atgcgtgagatcgtgcacatccaggcgggccagtgcggcaaccagatcggcgccaagttttgggaggtcatcagtgatgagcatgggattgaccccactggcagttaccatggagacagtgatttgcagctggagagaatcaatgtttactacaatgaagccactggtaacaaatatgttcctcgggccatcctcgtggatctggagccaggcacgatggattcggttaggtctggaccattcggccagatcttcagaccagacaatttcgtgtttggccagagtggagccgggaataactgggccaagggccactacacagagggagccgagctggtcgactcggtcctggatgtggtgaggaaggagtcagagagctgtgactgtctccagggcttccagctgacccactctctggggggcggcacggggtccgggatgggcaccctgctcatcagcaagatccgggaagagtacccagaccgcatcatgaacaccttcagcgtcatgccctcacccaaggtgtcagacacggtggtggagccctacaacgccaccctctcggtccaccagctggtggaaaacacagatgaaacctactgcattgacaacgaggccctgtatgacatctgcttccgcaccctgaagctgaccacccccacctacggggacctcaaccacctggtgtcggccaccatgagcggggtcaccacctgcctgcgcttcccgggccagctgaacgcagacctgcgcaagctggcggtgaacatggtgcccttccctcgcctgcacttcttcatgcccggcttcgcgcccctgaccagccggggcagccagcagtaccgggcgctcacggtgcccgagctcacccagcagatgttcgactccaagaacatgatggccgcctgcgacccgcgccacggccgctacctgacggtggctgccatcttccggggccgcatgtccatgaaggaggtggacgagcagatgctcaacgtgcagaacaagaacagcagctacttcgtggagtggatccccaacaacgtgaagacggccgtgtgcgacatcccgccccgcggcctgaagatgtcggccaccttcatcggcaacagcacggccatccaggagctgttcaagcgcatctccgagcagttcacggccatgttccggcgcaaggccttcctgcactggtacacgggcgagggcatggacgagatggagttcaccgaggccgagagcaacatgaacgacctggtgtccgagtaccagcagtaccaggacgccacggccgacgaacaaggggagttcgaggaggaggagggcgaggacgaggcgtag
Sequence Length
1338
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,953 Da
NCBI Official Full Name
Homo sapiens tubulin, beta 2B, mRNA
NCBI Official Synonym Full Names
tubulin beta 2B class IIb
NCBI Official Symbol
TUBB2B
NCBI Official Synonym Symbols
PMGYSA; bA506K6.1
NCBI Protein Information
tubulin beta-2B chain
UniProt Protein Name
Tubulin beta-2B chain
Protein Family
UniProt Gene Name
TUBB2B
UniProt Entry Name
TBB2B_HUMAN
NCBI Description
The protein encoded by this gene is a beta isoform of tubulin, which binds GTP and is a major component of microtubules. This gene is highly similar to TUBB2A and TUBB2C. Defects in this gene are a cause of asymmetric polymicrogyria. [provided by RefSeq, Mar 2010]
Uniprot Description
TUBB2B: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha-chain. TUBB2B is implicated in neuronal migration. Defects in TUBB2B are a cause of polymicrogyria asymmetric (PMGA). PMGA is a malformation of the cortex in which the brain surface is irregular and characterized by an excessive number of small gyri with abnormal lamination. Belongs to the tubulin family.
Protein type: Cytoskeletal
Chromosomal Location of Human Ortholog: 6p25
Cellular Component: microtubule; nucleus
Molecular Function: protein binding
Biological Process: neuron migration
Disease: Polymicrogyria, Symmetric Or Asymmetric
Research Articles on TUBB2B
Similar Products
Product Notes
The TUBB2B tubb2b (Catalog #AAA1271162) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgtgaga tcgtgcacat ccaggcgggc cagtgcggca accagatcgg cgccaagttt tgggaggtca tcagtgatga gcatgggatt gaccccactg gcagttacca tggagacagt gatttgcagc tggagagaat caatgtttac tacaatgaag ccactggtaa caaatatgtt cctcgggcca tcctcgtgga tctggagcca ggcacgatgg attcggttag gtctggacca ttcggccaga tcttcagacc agacaatttc gtgtttggcc agagtggagc cgggaataac tgggccaagg gccactacac agagggagcc gagctggtcg actcggtcct ggatgtggtg aggaaggagt cagagagctg tgactgtctc cagggcttcc agctgaccca ctctctgggg ggcggcacgg ggtccgggat gggcaccctg ctcatcagca agatccggga agagtaccca gaccgcatca tgaacacctt cagcgtcatg ccctcaccca aggtgtcaga cacggtggtg gagccctaca acgccaccct ctcggtccac cagctggtgg aaaacacaga tgaaacctac tgcattgaca acgaggccct gtatgacatc tgcttccgca ccctgaagct gaccaccccc acctacgggg acctcaacca cctggtgtcg gccaccatga gcggggtcac cacctgcctg cgcttcccgg gccagctgaa cgcagacctg cgcaagctgg cggtgaacat ggtgcccttc cctcgcctgc acttcttcat gcccggcttc gcgcccctga ccagccgggg cagccagcag taccgggcgc tcacggtgcc cgagctcacc cagcagatgt tcgactccaa gaacatgatg gccgcctgcg acccgcgcca cggccgctac ctgacggtgg ctgccatctt ccggggccgc atgtccatga aggaggtgga cgagcagatg ctcaacgtgc agaacaagaa cagcagctac ttcgtggagt ggatccccaa caacgtgaag acggccgtgt gcgacatccc gccccgcggc ctgaagatgt cggccacctt catcggcaac agcacggcca tccaggagct gttcaagcgc atctccgagc agttcacggc catgttccgg cgcaaggcct tcctgcactg gtacacgggc gagggcatgg acgagatgga gttcaccgag gccgagagca acatgaacga cctggtgtcc gagtaccagc agtaccagga cgccacggcc gacgaacaag gggagttcga ggaggaggag ggcgaggacg aggcgtag. It is sometimes possible for the material contained within the vial of "TUBB2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
