Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FN3K cdna clone

FN3K cDNA Clone

Synonyms
FN3K; FN3K cDNA Clone; FN3K cdna clone
Ordering
For Research Use Only!
Sequence
atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcctggaggccctccggagcacgggcctggtgcgggtgccgaggcccatgaaggtcatcgacctgccgggaggtggggccgcctttgtgatggagcatttgaagatgaagagcttgagcagtcaagcatcaaaacttggagagcagatggcagatttgcatctttacaaccagaagctcagggagaagttgaaggaggaggagaacacagtgggccgaagaggtgagggtgctgagcctcagtatgtggacaagttcggcttccacacggtgacgtgctgcggcttcatcccgcaggtgaatgagtggcaggatgactggccgacctttttcgcccggcaccggctccaggcgcagctggacctcattgagaaggactatgctgaccgagaggcacgagaactctggtcccggctacaggtgaagatcccggatctgttttgtggcctagagattgtccccgcgttgctccacggggatctctggtcgggaaacgtggctgaggacgacgtggggcccattatttacgacccggcttccttctatggccattccgagtttgaactggcaatcgccttgatgtttggggggttccccagatccttcttcaccgcctaccaccggaagatccccaaggctccgggcttcgaccagcggctgctgctctaccagctgtttaactacctgaaccactggaaccacttcgggcgggagtacaggagcccttcgttgggcaccatgcgaaggctgctcaagtag
Sequence Length
930
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,171 Da
NCBI Official Full Name
Homo sapiens fructosamine 3 kinase, mRNA
NCBI Official Synonym Full Names
fructosamine 3 kinase
NCBI Official Symbol
FN3K
NCBI Protein Information
fructosamine-3-kinase
UniProt Protein Name
Fructosamine-3-kinase
Protein Family
UniProt Gene Name
FN3K
UniProt Entry Name
FN3K_HUMAN

NCBI Description

A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation. [provided by RefSeq, Feb 2012]

Uniprot Description

FN3K: May initiate a process leading to the deglycation of fructoselysine and of glycated proteins. May play a role in the phosphorylation of 1-deoxy-1-morpholinofructose (DMF), fructoselysine, fructoseglycine, fructose and glycated lysozyme. Belongs to the fructosamine kinase family.

Protein type: Kinase, other; EC 2.7.1.-

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytosol

Molecular Function: fructosamine-3-kinase activity; kinase activity

Biological Process: epithelial cell differentiation; fructosamine metabolic process; post-translational protein modification

Research Articles on FN3K

Similar Products

Product Notes

The FN3K fn3k (Catalog #AAA1271119) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcagc tgctgcgcgc cgagctgcgc accgcgaccc tgcgggcctt cggcggcccc ggcgccggct gcatcagcga gggccgagcc tacgacacgg acgcaggccc agtgttcgtc aaagtcaacc gcaggacgca ggcccggcag atgtttgagg gggaggtggc cagcctggag gccctccgga gcacgggcct ggtgcgggtg ccgaggccca tgaaggtcat cgacctgccg ggaggtgggg ccgcctttgt gatggagcat ttgaagatga agagcttgag cagtcaagca tcaaaacttg gagagcagat ggcagatttg catctttaca accagaagct cagggagaag ttgaaggagg aggagaacac agtgggccga agaggtgagg gtgctgagcc tcagtatgtg gacaagttcg gcttccacac ggtgacgtgc tgcggcttca tcccgcaggt gaatgagtgg caggatgact ggccgacctt tttcgcccgg caccggctcc aggcgcagct ggacctcatt gagaaggact atgctgaccg agaggcacga gaactctggt cccggctaca ggtgaagatc ccggatctgt tttgtggcct agagattgtc cccgcgttgc tccacgggga tctctggtcg ggaaacgtgg ctgaggacga cgtggggccc attatttacg acccggcttc cttctatggc cattccgagt ttgaactggc aatcgccttg atgtttgggg ggttccccag atccttcttc accgcctacc accggaagat ccccaaggct ccgggcttcg accagcggct gctgctctac cagctgttta actacctgaa ccactggaac cacttcgggc gggagtacag gagcccttcg ttgggcacca tgcgaaggct gctcaagtag. It is sometimes possible for the material contained within the vial of "FN3K, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.