KLHL32 cdna clone
KLHL32 cDNA Clone
Gene Names
KLHL32; BKLHD5; KIAA1900; dJ21F7.1; UG0030H05
Synonyms
KLHL32; KLHL32 cDNA Clone; KLHL32 cdna clone
Sequence
atgccgtctgaacgctgcctcagtattcaagaaatgctgacaggccagaggctctgccactccgaatctcacaatgacagtgtcctggcagcgctgaatcagcagaggagtgatggcatcctctgcgacatcaccctgattgctgaggaacagaaattccatgctcacaaggcagtcctagcagcatgcagtgactatttccgggcaatgttcagtctttgtatggtggaaagtggagctgatgaggttaatttgcacggtgtgaccagccttggcttaaagcaggctctggagtttgcatacacaggacagattttgctggagccaggtgtgatccaggatgtgctagcagcgggcagtcacctacagctgttggagcttctcaatttatgctcccactatctcatccaggaattaaatagctttaattacttggatctgtacagacttgctgacctctttaacctcactttgttggagaaggcagtgatcgatttcttagtgaaacatctctctgaactcctgaagagccgcccagaagaagttctaacgcttccctattgcctgcttcaggaggtgctgaagagcgaccgcctgacctccctgagtgaagagcagatctggcagctagctgtgaggtggttggaacacaactgccactaccagtacatggacgagctcctgcaatacatccgctttggcctaatggatgtggatactctccatacagttgccctgtcccacccccttgtccaagcaagtgagactgcaacagcccttgtcaacgaggccctggaataccaccagagcatctatgcacagcctgtctggcagactcgcaggaccaaaccacgattccagtcagacactctgtatatcattggtgggaaaaagcgcgaggtctgcaaggtcaaggaacttcggtacttcaatcctgttgatcaggagaatgctctcatagctgccattgccaactggagtgagctggctcccatgcctgtgggaaggagccaccattgtgtggcagtcatgggggacttcctgtttgtggcaggaggggaagttgagcatgccagtggccggacgtgtgctgtgaggactgcctgtcgctatgacccccgcagtaattcctgggcagagatagcacccatgaaaaactgccgggagcattttgtgctgggtgccatggaggaatacctctatgcagttgggggcagaaatgaactgcgccaggttctgcctacagttgagcgatattgccccaagaagaacaaatggacttttgttcagtcctttgacagatccctttcatgccatgctggatatgtggctgatggtcttctttggatatcaggtagaacatacctcatgttggatttatcaaaacacactttcattgtggtatatatttaa
Sequence Length
1413
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,953 Da
NCBI Official Full Name
Homo sapiens kelch-like 32 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 32
NCBI Official Symbol
KLHL32
NCBI Official Synonym Symbols
BKLHD5; KIAA1900; dJ21F7.1; UG0030H05
NCBI Protein Information
kelch-like protein 32
UniProt Protein Name
Kelch-like protein 32
Protein Family
UniProt Gene Name
KLHL32
UniProt Synonym Gene Names
BKLHD5; KIAA1900
UniProt Entry Name
KLH32_HUMAN
Uniprot Description
KLHL32: 3 isoforms of the human protein are produced by alternative splicing
Chromosomal Location of Human Ortholog: 6q16.1
Molecular Function: ubiquitin-protein ligase activity
Biological Process: protein ubiquitination during ubiquitin-dependent protein catabolic process
Similar Products
Product Notes
The KLHL32 klhl32 (Catalog #AAA1271045) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtctg aacgctgcct cagtattcaa gaaatgctga caggccagag gctctgccac tccgaatctc acaatgacag tgtcctggca gcgctgaatc agcagaggag tgatggcatc ctctgcgaca tcaccctgat tgctgaggaa cagaaattcc atgctcacaa ggcagtccta gcagcatgca gtgactattt ccgggcaatg ttcagtcttt gtatggtgga aagtggagct gatgaggtta atttgcacgg tgtgaccagc cttggcttaa agcaggctct ggagtttgca tacacaggac agattttgct ggagccaggt gtgatccagg atgtgctagc agcgggcagt cacctacagc tgttggagct tctcaattta tgctcccact atctcatcca ggaattaaat agctttaatt acttggatct gtacagactt gctgacctct ttaacctcac tttgttggag aaggcagtga tcgatttctt agtgaaacat ctctctgaac tcctgaagag ccgcccagaa gaagttctaa cgcttcccta ttgcctgctt caggaggtgc tgaagagcga ccgcctgacc tccctgagtg aagagcagat ctggcagcta gctgtgaggt ggttggaaca caactgccac taccagtaca tggacgagct cctgcaatac atccgctttg gcctaatgga tgtggatact ctccatacag ttgccctgtc ccaccccctt gtccaagcaa gtgagactgc aacagccctt gtcaacgagg ccctggaata ccaccagagc atctatgcac agcctgtctg gcagactcgc aggaccaaac cacgattcca gtcagacact ctgtatatca ttggtgggaa aaagcgcgag gtctgcaagg tcaaggaact tcggtacttc aatcctgttg atcaggagaa tgctctcata gctgccattg ccaactggag tgagctggct cccatgcctg tgggaaggag ccaccattgt gtggcagtca tgggggactt cctgtttgtg gcaggagggg aagttgagca tgccagtggc cggacgtgtg ctgtgaggac tgcctgtcgc tatgaccccc gcagtaattc ctgggcagag atagcaccca tgaaaaactg ccgggagcat tttgtgctgg gtgccatgga ggaatacctc tatgcagttg ggggcagaaa tgaactgcgc caggttctgc ctacagttga gcgatattgc cccaagaaga acaaatggac ttttgttcag tcctttgaca gatccctttc atgccatgct ggatatgtgg ctgatggtct tctttggata tcaggtagaa catacctcat gttggattta tcaaaacaca ctttcattgt ggtatatatt taa. It is sometimes possible for the material contained within the vial of "KLHL32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
