Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TWF2 cdna clone

TWF2 cDNA Clone

Gene Names
TWF2; A6r; A6RP; PTK9L; MSTP011
Synonyms
TWF2; TWF2 cDNA Clone; TWF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcaccaaacgggcatccacgccacggaagagctgaaggaattctttgccaaggcacgggctggctctgtgcggctcatcaaggttgtgattgaggacgagcagctcgtgctgggtgcctcgcaggagccagtaggccgctgggatcaggactatgacagggccgtgctgccactgctggacgcccagcagccctgctacctgctctaccgcctcgactcacagaatgctcagggcttcgaatggctcttcctcgcctggtcgcctgataactcccccgtgcggctgaagatgctgtacgcggccacgcgggccacagtgaaaaaggagtttggaggtggccacatcaaggatgagctcttcgggactgtgaaggatgacctctcttttgctgggtaccagaaacacctgtcgtcctgtgcggcacctgccccgctgacctcggctgagagagagctccagcagatccgcattaacgaggtgaagacagagatcagtgtggaaagcaagcaccagaccctgcagggcctcgccttccccctgcagcctgaggcccagcgggcactccagcagctcaagcagaaaatggtcaactacatccagatgaagctggacctagagcgggaaaccattgagctggtgcacacagagcccacggatgtggcccagctgccctcccgggtgccccgagatgctgcccgctaccacttcttcctctacaagcacacccatgagggcgacccccttgagtctgtagtgttcatctactccatgccggggtacaagtgcagcatcaaggagcgaatgctctactccagctgcaagagccgcctcctcgactccgtggagcaggacttccatctggagatcgccaagaaaattgagattggcgatggggcagagctgacggcagagttcctctacgacgaggtgcaccccaagcaacacgccttcaagcaggccttcgccaagcccaagggcccagggggcaagcggggccataagcgcctcatccgcggcccgggtgaaaatggggatgacagctag
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,548 Da
NCBI Official Full Name
Homo sapiens twinfilin, actin-binding protein, homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
twinfilin actin binding protein 2
NCBI Official Symbol
TWF2
NCBI Official Synonym Symbols
A6r; A6RP; PTK9L; MSTP011
NCBI Protein Information
twinfilin-2
UniProt Protein Name
Twinfilin-2
Protein Family
UniProt Gene Name
TWF2
UniProt Synonym Gene Names
PTK9L; hA6RP
UniProt Entry Name
TWF2_HUMAN

NCBI Description

The protein encoded by this gene was identified by its interaction with the catalytic domain of protein kinase C-zeta. The encoded protein contains an actin-binding site and an ATP-binding site. It is most closely related to twinfilin (PTK9), a conserved actin monomer-binding protein. [provided by RefSeq, Jul 2008]

Uniprot Description

A6r: Actin-binding protein involved in motile and morphological processes. Inhibits actin polymerization, likely by sequestering G-actin. By capping the barbed ends of filaments, it also regulates motility. Seems to play an important role in clathrin-mediated endocytosis and distribution of endocytic organelles. May play a role in regulating the mature length of the middle and short rows of stereocilia. Belongs to the actin-binding proteins ADF family. Twinfilin subfamily.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3p21.1

Cellular Component: cell-cell adherens junction; cytoplasm; filopodium; growth cone; lamellipodium; myofibril; perinuclear region of cytoplasm; stereocilium

Molecular Function: actin monomer binding; ATP binding; phosphatidylinositol-4,5-bisphosphate binding; protein binding; protein kinase C binding

Biological Process: barbed-end actin filament capping; negative regulation of actin filament polymerization; positive regulation of axon extension; regulation of actin cytoskeleton organization and biogenesis; regulation of microvillus length; sequestering of actin monomers

Research Articles on TWF2

Similar Products

Product Notes

The TWF2 twf2 (Catalog #AAA1270894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcacc aaacgggcat ccacgccacg gaagagctga aggaattctt tgccaaggca cgggctggct ctgtgcggct catcaaggtt gtgattgagg acgagcagct cgtgctgggt gcctcgcagg agccagtagg ccgctgggat caggactatg acagggccgt gctgccactg ctggacgccc agcagccctg ctacctgctc taccgcctcg actcacagaa tgctcagggc ttcgaatggc tcttcctcgc ctggtcgcct gataactccc ccgtgcggct gaagatgctg tacgcggcca cgcgggccac agtgaaaaag gagtttggag gtggccacat caaggatgag ctcttcggga ctgtgaagga tgacctctct tttgctgggt accagaaaca cctgtcgtcc tgtgcggcac ctgccccgct gacctcggct gagagagagc tccagcagat ccgcattaac gaggtgaaga cagagatcag tgtggaaagc aagcaccaga ccctgcaggg cctcgccttc cccctgcagc ctgaggccca gcgggcactc cagcagctca agcagaaaat ggtcaactac atccagatga agctggacct agagcgggaa accattgagc tggtgcacac agagcccacg gatgtggccc agctgccctc ccgggtgccc cgagatgctg cccgctacca cttcttcctc tacaagcaca cccatgaggg cgaccccctt gagtctgtag tgttcatcta ctccatgccg gggtacaagt gcagcatcaa ggagcgaatg ctctactcca gctgcaagag ccgcctcctc gactccgtgg agcaggactt ccatctggag atcgccaaga aaattgagat tggcgatggg gcagagctga cggcagagtt cctctacgac gaggtgcacc ccaagcaaca cgccttcaag caggccttcg ccaagcccaa gggcccaggg ggcaagcggg gccataagcg cctcatccgc ggcccgggtg aaaatgggga tgacagctag. It is sometimes possible for the material contained within the vial of "TWF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.