Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL13 cdna clone

IL13 cDNA Clone

Gene Names
IL13; P600; IL-13
Synonyms
IL13; IL13 cDNA Clone; IL13 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGA
Sequence Length
441
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,816 Da
NCBI Official Full Name
Homo sapiens interleukin 13, mRNA
NCBI Official Synonym Full Names
interleukin 13
NCBI Official Symbol
IL13
NCBI Official Synonym Symbols
P600; IL-13
NCBI Protein Information
interleukin-13
UniProt Protein Name
Interleukin-13
Protein Family
UniProt Gene Name
IL13
UniProt Synonym Gene Names
NC30; IL-13
UniProt Entry Name
IL13_HUMAN

NCBI Description

This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4. [provided by RefSeq, Jul 2008]

Uniprot Description

IL13: Cytokine. Inhibits inflammatory cytokine production. Synergizes with IL2 in regulating interferon-gamma synthesis. May be critical in regulating inflammatory and immune responses. Defects in IL13 may be a cause of susceptibility to allergic rhinitis (ALRH). Allergic rhinitis is a common disease of complex inheritance and is characterized by mucosal inflammation caused by allergen exposure. Belongs to the IL-4/IL-13 family.

Protein type: Secreted; Secreted, signal peptide; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: extracellular region; extracellular space

Molecular Function: interleukin-13 receptor binding; protein binding

Biological Process: cell motility; cell-cell signaling; positive regulation of B cell proliferation; positive regulation of immunoglobulin production; positive regulation of macrophage activation; positive regulation of mast cell degranulation

Disease: Allergic Rhinitis; Asthma, Susceptibility To

Research Articles on IL13

Similar Products

Product Notes

The IL13 il13 (Catalog #AAA1270752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCATCCGC TCCTCAATCC TCTCCTGTTG GCACTGGGCC TCATGGCGCT TTTGTTGACC ACGGTCATTG CTCTCACTTG CCTTGGCGGC TTTGCCTCCC CAGGCCCTGT GCCTCCCTCT ACAGCCCTCA GGGAGCTCAT TGAGGAGCTG GTCAACATCA CCCAGAACCA GAAGGCTCCG CTCTGCAATG GCAGCATGGT ATGGAGCATC AACCTGACAG CTGGCATGTA CTGTGCAGCC CTGGAATCCC TGATCAACGT GTCAGGCTGC AGTGCCATCG AGAAGACCCA GAGGATGCTG AGCGGATTCT GCCCGCACAA GGTCTCAGCT GGGCAGTTTT CCAGCTTGCA TGTCCGAGAC ACCAAAATCG AGGTGGCCCA GTTTGTAAAG GACCTGCTCT TACATTTAAA GAAACTTTTT CGCGAGGGAC AGTTCAACTG A. It is sometimes possible for the material contained within the vial of "IL13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.