Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNE1L cdna clone

KCNE1L cDNA Clone

Gene Names
KCNE5; KCNE1L
Synonyms
KCNE1L; KCNE1L cDNA Clone; KCNE1L cdna clone
Ordering
For Research Use Only!
Sequence
atgaactgcagcgagagccagcggctgcgaacccttctgagccgcctgttgctcgagctgcaccaccggggtaatgccagcggcttgggcgctggccctcgtcccagcatgggcatgggggtcgtgcctgaccctttcgtgggccgcgaggtgaccagcgccaagggcgacgacgcctatctctacatcctgctcatcatgatcttctacgcctgcttggccggaggcctcatcctggcctacacccgctcccgtaagctcgtcgaggccaaggacgagccgtcccaggcttgcgccgagcacgaatgggccccgggaggcgccctgaccgccgacgccgaggctgccgcgggctcccaggccgagggccgccgccagcttgcctccgaggggctgcctgccctcgcccagggcgctgagcgggtctaa
Sequence Length
429
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,993 Da
NCBI Official Full Name
Homo sapiens KCNE1-like, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily E regulatory subunit 5
NCBI Official Symbol
KCNE5
NCBI Official Synonym Symbols
KCNE1L
NCBI Protein Information
potassium voltage-gated channel subfamily E regulatory beta subunit 5
UniProt Protein Name
Potassium voltage-gated channel subfamily E regulatory beta subunit 5
UniProt Gene Name
KCNE5
UniProt Entry Name
KCNE5_HUMAN

NCBI Description

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a membrane protein which has sequence similarity to the KCNE1 gene product, a member of the potassium channel, voltage-gated, isk-related subfamily. This intronless gene is deleted in AMME contiguous gene syndrome and may be involved in the cardiac and neurologic abnormalities found in the AMME contiguous gene syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

KCNE1L: Defects in KCNE1L are involved in Alport syndrome with mental retardation midface hypoplasia and elliptocytosis (ATS-MR). A X-linked contiguous gene deletion syndrome characterized by glomerulonephritis, deafness, mental retardation, midface hypoplasia and elliptocytosis. Belongs to the potassium channel KCNE family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq22.3

Cellular Component: plasma membrane; voltage-gated potassium channel complex

Molecular Function: potassium channel regulator activity; protein binding; voltage-gated potassium channel activity

Biological Process: cardiac muscle contraction; regulation of heart contraction

Research Articles on KCNE1L

Similar Products

Product Notes

The KCNE1L kcne5 (Catalog #AAA1270733) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactgca gcgagagcca gcggctgcga acccttctga gccgcctgtt gctcgagctg caccaccggg gtaatgccag cggcttgggc gctggccctc gtcccagcat gggcatgggg gtcgtgcctg accctttcgt gggccgcgag gtgaccagcg ccaagggcga cgacgcctat ctctacatcc tgctcatcat gatcttctac gcctgcttgg ccggaggcct catcctggcc tacacccgct cccgtaagct cgtcgaggcc aaggacgagc cgtcccaggc ttgcgccgag cacgaatggg ccccgggagg cgccctgacc gccgacgccg aggctgccgc gggctcccag gccgagggcc gccgccagct tgcctccgag gggctgcctg ccctcgccca gggcgctgag cgggtctaa. It is sometimes possible for the material contained within the vial of "KCNE1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.