Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM69 cdna clone

TRIM69 cDNA Clone

Gene Names
TRIM69; Trif; HSD34; RNF36; HSD-34
Synonyms
TRIM69; TRIM69 cDNA Clone; TRIM69 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaggagcttgccatccaacagggtcaactggagacaactctgaaggagcttcagaccctgaggaacatgcagaaggaagctattgctgctcacaaggaaaacaagctacatctgcagcaacatgtgtccatggagtttctaaagctgcatcagttcctgcacagcaaagaaaaggacattttaactgagctccgggaagaggggaaagccttgaatgaggagatggagttgaatctgagccagcttcaggagcaatgtctcttagccaaggatatgttggtgagcattcaggcaaagacggaacaacagaactccttcgactttctcaaagacatcacaactctcttacatagcttggagcaaggaatgaaggtgctggcaaccagagagcttatttccagaaagctgaacctgggccagtacaaaggtcctatccagtacatggtatggagggaaatgcaggacactctctgcccaggcctgtctccactaactctggaccctaaaacagctcacccaaatctggtgctctccaaaagccaaaccagcgtctggcatggtgacattaagaagataatgcctgatgatcctgagaggtttgactcaagtgtggctgtactgggctcaagaggcttcacctctggaaagtggtactgggaagtagaagtagcaaagaagacaaaatggacagttggagttgtcagagaatccatcattcggaagggcagctgtcctctaactcctgagcaaggattctggcttttaagactaaggaaccaaactgatctaaaggctctggatttgccttctttcagtctgacactgactaacaacctcgacaaggtgggcatatacctggattatgaaggaggacagttgtccttctacaatgctaaaaccatgactcacatttacaccttcagtaacactttcatggagaaactttatccctacttctgcccctgccttaatgatggtggagagaataaagaaccattgcacatcttacatccacagtaa
Sequence Length
1026
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,068 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 69, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 69
NCBI Official Symbol
TRIM69
NCBI Official Synonym Symbols
Trif; HSD34; RNF36; HSD-34
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM69
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM69
UniProt Gene Name
TRIM69
UniProt Synonym Gene Names
RNF36
UniProt Entry Name
TRI69_HUMAN

NCBI Description

This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM69: May play a role in apoptosis. Belongs to the TRIM/RBCC family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 15q21.1

Cellular Component: cytoplasm; cytosol; nuclear speck; nucleus; plasma membrane

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein polyubiquitination

Research Articles on TRIM69

Similar Products

Product Notes

The TRIM69 trim69 (Catalog #AAA1270664) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg agcttgccat ccaacagggt caactggaga caactctgaa ggagcttcag accctgagga acatgcagaa ggaagctatt gctgctcaca aggaaaacaa gctacatctg cagcaacatg tgtccatgga gtttctaaag ctgcatcagt tcctgcacag caaagaaaag gacattttaa ctgagctccg ggaagagggg aaagccttga atgaggagat ggagttgaat ctgagccagc ttcaggagca atgtctctta gccaaggata tgttggtgag cattcaggca aagacggaac aacagaactc cttcgacttt ctcaaagaca tcacaactct cttacatagc ttggagcaag gaatgaaggt gctggcaacc agagagctta tttccagaaa gctgaacctg ggccagtaca aaggtcctat ccagtacatg gtatggaggg aaatgcagga cactctctgc ccaggcctgt ctccactaac tctggaccct aaaacagctc acccaaatct ggtgctctcc aaaagccaaa ccagcgtctg gcatggtgac attaagaaga taatgcctga tgatcctgag aggtttgact caagtgtggc tgtactgggc tcaagaggct tcacctctgg aaagtggtac tgggaagtag aagtagcaaa gaagacaaaa tggacagttg gagttgtcag agaatccatc attcggaagg gcagctgtcc tctaactcct gagcaaggat tctggctttt aagactaagg aaccaaactg atctaaaggc tctggatttg ccttctttca gtctgacact gactaacaac ctcgacaagg tgggcatata cctggattat gaaggaggac agttgtcctt ctacaatgct aaaaccatga ctcacattta caccttcagt aacactttca tggagaaact ttatccctac ttctgcccct gccttaatga tggtggagag aataaagaac cattgcacat cttacatcca cagtaa. It is sometimes possible for the material contained within the vial of "TRIM69, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.