Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TM7SF2 cdna clone

TM7SF2 cDNA Clone

Gene Names
TM7SF2; ANG1; NET47; DHCR14A
Synonyms
TM7SF2; TM7SF2 cDNA Clone; TM7SF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccccactcagggcccccgggccccgctggaattcggagggcccctgggcgccgcggctctgctactgctgctgcccgccaccatgttccacctgctcctggcggcccgttcgggccccgcgcgcctgctgggtccacccgcgtccctgcccgggctggaggtgctgtggagcccacgggcgctgctgctgtggctcgcctggctcggcctgcaggcggcgctctacctactgccggcgcgcaaggtggccgaggggcaggaattgaaggacaagagtcgcctgcgctatcctattaacggcttccaggccctggtgctgacagccctgttggtggggctggggatgtcagcggggctgcctctgggggcgctcccggaaatgctcctgcccttggcgtttgtcgccaccctcaccgctttcatcttcagcctttttctctacatgaaggcgcaggtagccccagtttcggccctggcacctggggggaactcaggcaatccgatttacgacttttttctgggacgagagctcaaccctcgtatctgtttcttcgacttcaaatatttctgtgaactgcgacccggcctcatcggctgggtcctcatcaacctggccctgttgatgaaggaggcagagcttcgaggcagtccctcactggccatgtggctggtcaatggcttccagttgctctacgtgggtgatgccctctggcacgaggaggccgtcctcaccaccatggatatcacacatgacgggtttggcttcatgctggcgtttggggacatggcctgggtgcccttcacctacagcctgcaggcccagttcctgctgcaccacccgcagcccctggggttgcccatggcctctgtcatctgcctcatcaatgctactggttactacatcttccgtggggcgaattcccagaaaaacactttccgaaagaatccttctgaccccagagtggctgggcttgagaccatctctacagccacagggcggaaactgctggtgtctgggtggtggggtatggtccgccatcccaactatcttggagacctcatcatggctctggcttggtccttgccctgcggggtgtcacacctgctgccctacttctacctcctctacttcaccgcgctgctggtgcaccgtgaggcccgggatgagcggcagtgcctgcagaagtacggcctggcctggcaggagtactgccggcgtgtgccttaccgcatcatgccctacatctactga
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,365 Da
NCBI Official Full Name
Homo sapiens transmembrane 7 superfamily member 2, mRNA
NCBI Official Synonym Full Names
transmembrane 7 superfamily member 2
NCBI Official Symbol
TM7SF2
NCBI Official Synonym Symbols
ANG1; NET47; DHCR14A
NCBI Protein Information
delta(14)-sterol reductase
UniProt Protein Name
Delta(14)-sterol reductase
UniProt Gene Name
TM7SF2
UniProt Synonym Gene Names
ANG1; Delta-14-SR
UniProt Entry Name
ERG24_HUMAN

Uniprot Description

TM7SF2: Involved in the conversion of lanosterol to cholesterol. Belongs to the ERG4/ERG24 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; Membrane protein, integral; Endoplasmic reticulum; Lipid Metabolism - steroid biosynthesis; EC 1.3.1.70; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; integral to plasma membrane; nuclear inner membrane; receptor complex

Molecular Function: delta14-sterol reductase activity; NADP binding; oxidoreductase activity, acting on the CH-CH group of donors

Biological Process: cholesterol biosynthetic process; sterol biosynthetic process

Research Articles on TM7SF2

Similar Products

Product Notes

The TM7SF2 tm7sf2 (Catalog #AAA1270581) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccca ctcagggccc ccgggccccg ctggaattcg gagggcccct gggcgccgcg gctctgctac tgctgctgcc cgccaccatg ttccacctgc tcctggcggc ccgttcgggc cccgcgcgcc tgctgggtcc acccgcgtcc ctgcccgggc tggaggtgct gtggagccca cgggcgctgc tgctgtggct cgcctggctc ggcctgcagg cggcgctcta cctactgccg gcgcgcaagg tggccgaggg gcaggaattg aaggacaaga gtcgcctgcg ctatcctatt aacggcttcc aggccctggt gctgacagcc ctgttggtgg ggctggggat gtcagcgggg ctgcctctgg gggcgctccc ggaaatgctc ctgcccttgg cgtttgtcgc caccctcacc gctttcatct tcagcctttt tctctacatg aaggcgcagg tagccccagt ttcggccctg gcacctgggg ggaactcagg caatccgatt tacgactttt ttctgggacg agagctcaac cctcgtatct gtttcttcga cttcaaatat ttctgtgaac tgcgacccgg cctcatcggc tgggtcctca tcaacctggc cctgttgatg aaggaggcag agcttcgagg cagtccctca ctggccatgt ggctggtcaa tggcttccag ttgctctacg tgggtgatgc cctctggcac gaggaggccg tcctcaccac catggatatc acacatgacg ggtttggctt catgctggcg tttggggaca tggcctgggt gcccttcacc tacagcctgc aggcccagtt cctgctgcac cacccgcagc ccctggggtt gcccatggcc tctgtcatct gcctcatcaa tgctactggt tactacatct tccgtggggc gaattcccag aaaaacactt tccgaaagaa tccttctgac cccagagtgg ctgggcttga gaccatctct acagccacag ggcggaaact gctggtgtct gggtggtggg gtatggtccg ccatcccaac tatcttggag acctcatcat ggctctggct tggtccttgc cctgcggggt gtcacacctg ctgccctact tctacctcct ctacttcacc gcgctgctgg tgcaccgtga ggcccgggat gagcggcagt gcctgcagaa gtacggcctg gcctggcagg agtactgccg gcgtgtgcct taccgcatca tgccctacat ctactga. It is sometimes possible for the material contained within the vial of "TM7SF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.