Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTCF cdna clone

CTCF cDNA Clone

Gene Names
CTCF; MRD21
Synonyms
CTCF; CTCF cDNA Clone; CTCF cdna clone
Ordering
For Research Use Only!
Sequence
atggaaggtgatgcagtcgaagccattgtggaggagtccgaaacttttattaaaggaaaggagagaaagacttaccagagacgccgggaagggggccaggaagaagatgcctgccacttaccccagaaccagacggatgggggtgaggtggtccaggatgtcaacagcagtgtacagatggtgatgatggaacagctggaccccacccttcttcagatgaagactgaagtaatggagggcacagtggctccagaagcagaggctgctgtggacgatacccagattataactttacaggttgtaaatatggaggaacagcccataaacataggagaacttcagcttgttcaagtacctgttcctgtgactgtacctgttgctaccacttcagtagaagaacttcagggggcttatgaaaatgaagtgtctaaagagggccttgcggaaagtgaacccatgatatgccacaccctacctttgcctgaagggtttcaggtggttaaagtgggggccaatggagaggtggagacactagaacaaggggaacttccaccccaggaagatcctagttggcaaaaagacccagactatcagccaccagccaaaaaaacaaagaaaaccaaaaagagcaaactgcgttatacagaggagggcaaagatgtagatgtgtctgtctacgattttgaggaagaacagcaggagggtctgctatcagaggttaatgcagagaaagtggttggtaatatgaagcctccaaagccaacaaaaattaaaaagaaaggtgtaaagaagacattccagtgtgagctttgcagttacacgtgtccacggcgttcaaatttggatcgtcacatgaaaagccacactgatgagagaccacacaagtgccatctctgtggcagggcattcagaacagtcaccctcctgaggaatcaccttaacacacacacaggtactcgtcctcacaagtgcccagactgcgacatggcctttgtgaccagtggagaattggttcggcatcgtcgttacaaacacacccacgagaagccattcaagtgttccatgtgcgattacgccagtgtagaagtcagcaaattaaaacgtcacattcgctctcatactggagagcgtccgtttcagtgcagtttgtgcagttatgccagcagggacacatacaagctgaaaaggcacatgagaacccattcaggggaaaagccttatgaatgttatatttgtcatgctcggtttacccaaagtggtaccatgaagatgcacattttacagaagcacacagaaaatgtggccaaatttcactgtccccactgtgacacagtcatagcccgaaaaagtgatttgggtgtccacttgcgaaagcagcattcctatattgagcaaggcaagaaatgccgttactgtgatgctgtgtttcatgagcgctatgccctcatccagcatcagaagtcacacaagaatgagaagcgctttaagtgtgaccagtgtgattacgcttgtagacaggagaggcacatgatcatgcacaagcgcacccacaccggggagaagccttacgcctgcagccactgcgataagaccttccgccagaagcagcttctcgacatgcacttcaagcgctatcacgaccccaacttcgtccctgcggcttttgtctgttctaagtgtgggaaaacatttacacgtcggaataccatggcaagacatgctgataattgtgctggcccagatggcgtagagggggaaaatggaggagaaacgaagaagagtaaacgtggaagaaaaagaaagatgcgctctaagaaagaagattcctctgacagtgaaaatgctgaaccagatctggacgacaatgaggatgaggaggagcctgccgtagaaattgaacctgagccagagcctcagcctgtgaccccagccccaccacccgccaagaagcggagaggacgaccccctggcagaaccaaccagcccaaacagaaccagccaacagctatcattcaggttgaagaccagaatacaggtgcaattgagaacattatagttgaagtaaaaaaagagccagatgctgagcccgcagagggagaggaagaggaggcccagccagctgccacagatgcccccaacggagacctcacgcccgagatgatcctcagcatgatggaccggtga
Sequence Length
2184
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,998 Da
NCBI Official Full Name
Homo sapiens CCCTC-binding factor (zinc finger protein), mRNA
NCBI Official Synonym Full Names
CCCTC-binding factor
NCBI Official Symbol
CTCF
NCBI Official Synonym Symbols
MRD21
NCBI Protein Information
transcriptional repressor CTCF
UniProt Protein Name
Transcriptional repressor CTCF
Protein Family
UniProt Gene Name
CTCF
UniProt Entry Name
CTCF_HUMAN

NCBI Description

This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

CTCF: a widely expressed, sequence-specific DNA-binding transcriptional regulator, insulator, and organizer of higher-order chromatin structure. Acts as a tumor suppressor. Contains 11 C2H2-type zinc fingers. Involved in promoter activation or repression, hormone-responsive gene silencing, methylation-dependent chromatin insulation, and genomic imprinting. Mediates pairing between X chromosomes and interactions between distant regulatory elements. Binds to promoters of c-myc, PLK, PIM1 and APP. A critical regulator of cell-cycle arrest and death after B cell receptor signaling in immature B cells. CTCF, together with YY1 and Tsix, form a regulated epigenetic switch for X-inactivation.

Protein type: C2H2-type zinc finger protein; Transcription factor; Tumor suppressor

Chromosomal Location of Human Ortholog: 16q21-q22.3

Cellular Component: chromosome, pericentric region; condensed chromosome; nucleolus; nucleoplasm; nucleus

Molecular Function: chromatin insulator sequence binding; protein binding; sequence-specific DNA binding; transcription corepressor activity; transcription factor activity; zinc ion binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; nucleosome positioning; positive regulation of transcription, DNA-dependent; regulation of gene expression, epigenetic; regulation of molecular function, epigenetic

Disease: Mental Retardation, Autosomal Dominant 21

Research Articles on CTCF

Similar Products

Product Notes

The CTCF ctcf (Catalog #AAA1270296) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaggtg atgcagtcga agccattgtg gaggagtccg aaacttttat taaaggaaag gagagaaaga cttaccagag acgccgggaa gggggccagg aagaagatgc ctgccactta ccccagaacc agacggatgg gggtgaggtg gtccaggatg tcaacagcag tgtacagatg gtgatgatgg aacagctgga ccccaccctt cttcagatga agactgaagt aatggagggc acagtggctc cagaagcaga ggctgctgtg gacgataccc agattataac tttacaggtt gtaaatatgg aggaacagcc cataaacata ggagaacttc agcttgttca agtacctgtt cctgtgactg tacctgttgc taccacttca gtagaagaac ttcagggggc ttatgaaaat gaagtgtcta aagagggcct tgcggaaagt gaacccatga tatgccacac cctacctttg cctgaagggt ttcaggtggt taaagtgggg gccaatggag aggtggagac actagaacaa ggggaacttc caccccagga agatcctagt tggcaaaaag acccagacta tcagccacca gccaaaaaaa caaagaaaac caaaaagagc aaactgcgtt atacagagga gggcaaagat gtagatgtgt ctgtctacga ttttgaggaa gaacagcagg agggtctgct atcagaggtt aatgcagaga aagtggttgg taatatgaag cctccaaagc caacaaaaat taaaaagaaa ggtgtaaaga agacattcca gtgtgagctt tgcagttaca cgtgtccacg gcgttcaaat ttggatcgtc acatgaaaag ccacactgat gagagaccac acaagtgcca tctctgtggc agggcattca gaacagtcac cctcctgagg aatcacctta acacacacac aggtactcgt cctcacaagt gcccagactg cgacatggcc tttgtgacca gtggagaatt ggttcggcat cgtcgttaca aacacaccca cgagaagcca ttcaagtgtt ccatgtgcga ttacgccagt gtagaagtca gcaaattaaa acgtcacatt cgctctcata ctggagagcg tccgtttcag tgcagtttgt gcagttatgc cagcagggac acatacaagc tgaaaaggca catgagaacc cattcagggg aaaagcctta tgaatgttat atttgtcatg ctcggtttac ccaaagtggt accatgaaga tgcacatttt acagaagcac acagaaaatg tggccaaatt tcactgtccc cactgtgaca cagtcatagc ccgaaaaagt gatttgggtg tccacttgcg aaagcagcat tcctatattg agcaaggcaa gaaatgccgt tactgtgatg ctgtgtttca tgagcgctat gccctcatcc agcatcagaa gtcacacaag aatgagaagc gctttaagtg tgaccagtgt gattacgctt gtagacagga gaggcacatg atcatgcaca agcgcaccca caccggggag aagccttacg cctgcagcca ctgcgataag accttccgcc agaagcagct tctcgacatg cacttcaagc gctatcacga ccccaacttc gtccctgcgg cttttgtctg ttctaagtgt gggaaaacat ttacacgtcg gaataccatg gcaagacatg ctgataattg tgctggccca gatggcgtag agggggaaaa tggaggagaa acgaagaaga gtaaacgtgg aagaaaaaga aagatgcgct ctaagaaaga agattcctct gacagtgaaa atgctgaacc agatctggac gacaatgagg atgaggagga gcctgccgta gaaattgaac ctgagccaga gcctcagcct gtgaccccag ccccaccacc cgccaagaag cggagaggac gaccccctgg cagaaccaac cagcccaaac agaaccagcc aacagctatc attcaggttg aagaccagaa tacaggtgca attgagaaca ttatagttga agtaaaaaaa gagccagatg ctgagcccgc agagggagag gaagaggagg cccagccagc tgccacagat gcccccaacg gagacctcac gcccgagatg atcctcagca tgatggaccg gtga. It is sometimes possible for the material contained within the vial of "CTCF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.