Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MID1 cdna clone

MID1 cDNA Clone

Gene Names
MID1; OS; FXY; OSX; OGS1; XPRF; BBBG1; GBBB1; MIDIN; RNF59; ZNFXY; TRIM18
Synonyms
MID1; MID1 cDNA Clone; MID1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaacactggagtcagaactgacctgccctatttgtctggagctctttgaggaccctcttctactgccctgcgcacacagcctctgcttcaactgcgcccaccgcatcctagtatcacactgtgccaccaacgagtctgtggagtccatcaccgccttccagtgccccacctgccggcatgtcatcaccctcagccagcgaggtctagacgggctcaagcgcaacgtcaccctacagaacatcatcgacaggttccagaaagcatcagtgagcgggcccaactctcccagcgagacccgtcgggagcgggcctttgacgccaacaccatgacctccgccgagaaggtcctctgccagttttgtgaccaggatcctgcccaggacgctgtgaagacctgtgtcacttgtgaagtatcctactgtgacgagtgcctgaaagccactcacccgaataagaagccctttacaggccatcgtctgattgagccaattccggactctcacatccgggggctgatgtgcttggagcatgaggatgagaaggtgaatatgtactgtgtgaccgatgaccagttaatctgtgccttgtgtaaactggttgggcggcaccgcgatcatcaggtggcagctttgagtgagcgctatgacaaattgaagcaaaacttagagagtaacctcaccaaccttattaagaggaacacagaactggagacccttttggctaaactcatccaaacctgtcaacatgttgaagtcaatgcatcacgtcaagaagccaaattgacagaggagtgtgatcttctcattgagatcattcagcaaagacgacagattattggaaccaagatcaaagaagggaaggtgatgaggcttcgcaaactggctcagcagattgcaaactgcaaacagtgcattgagcggtcagcatcactcatctcccaagcggaacactctctgaaggagaatgatcatgcgcgtttcctacagactgctaagaatatcaccgagagagtctccatggcaactgcatcctcccaggttctaattcctgaaatcaacctcaatgacacatttgacacctttgccttagatttttcccgagagaagaaactgctagaatgtctggattaccttacagctcccaaccctcccacaattagagaagagctctgcacagcttcatatgacaccatcactgtgcattggacctccgatgatgagttcagcgtggtctcctacgagctccagtacaccatattcaccggacaagccaacgtcgttagtctgtgtaattcggctgatagctggatgatagtacccaacatcaagcagaaccactacacggtgcacggtctgcagagcggcaccaagtacatcttcatggtcaaggccatcaaccaggcgggcagccgcagcagtgagcctgggaagttgaagacaaacagccaaccatttaaactggatcccaaatctgctcatcgaaaactgaaggtgtcccatgataacttgacagtagaacgtgatgagtcatcatccaagaagagtcacacacctgaacgcttcaccagccaggggagctatggagtagctggaaatgtgtttattgatagtggccggcattattgggaagtggtcataagtggaagcacatggtatgccattggtcttgcttacaaatcagccccgaagcatgaatggattgggaagaactctgcttcctgggcgctctgccgctgcaacaataactgggtggtgagacacaatagcaaggaaatccccattgagcctgccccccacctccggcgcgtgggcatcctgctggactatgataacggctctatcgccttttatgatgctttgaactccatccacctctacaccttcgacgtcgcatttgcgcagcctgtttgccccaccttcaccgtgtggaacaagtgtctgacgattatcactgggctccctatcccagaccatttggactgcacagagcagctgccgtga
Sequence Length
2004
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,288 Da
NCBI Official Full Name
Homo sapiens midline 1 (Opitz/BBB syndrome), mRNA
NCBI Official Synonym Full Names
midline 1
NCBI Official Symbol
MID1
NCBI Official Synonym Symbols
OS; FXY; OSX; OGS1; XPRF; BBBG1; GBBB1; MIDIN; RNF59; ZNFXY; TRIM18
NCBI Protein Information
E3 ubiquitin-protein ligase Midline-1
UniProt Protein Name
E3 ubiquitin-protein ligase Midline-1
Protein Family
UniProt Gene Name
MID1
UniProt Synonym Gene Names
FXY; RNF59; TRIM18; XPRF
UniProt Entry Name
TRI18_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Multiple different transcript variants are generated by alternate splicing; however, the full-length nature of some of the variants has not been determined. [provided by RefSeq, Jul 2010]

Uniprot Description

MID1: Has E3 ubiquitin ligase activity towards IGBP1, promoting its monoubiquitination, which results in deprotection of the catalytic subunit of protein phosphatase PP2A, and its subsequent degradation by polyubiquitination. Defects in MID1 are the cause of Opitz GBBB syndrome 1 (OGS1). A congenital midline malformation syndrome characterized by hypertelorism, genital-urinary defects such as hypospadias in males and splayed labia in females, lip-palate- laryngotracheal clefts, imperforate anus, developmental delay and congenital heart defects. MID1 mutations produce proteins with a decreased affinity for microtubules. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; EC 6.3.2.-; Ubiquitin ligase; Ubiquitin conjugating system; Ligase; Cytoskeletal

Chromosomal Location of Human Ortholog: Xp22

Cellular Component: cytoplasmic microtubule; cytosol; microtubule; microtubule associated complex

Molecular Function: identical protein binding; microtubule binding; phosphoprotein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; ubiquitin protein ligase binding

Biological Process: microtubule cytoskeleton organization and biogenesis; pattern specification process; positive regulation of stress-activated MAPK cascade

Disease: Opitz Gbbb Syndrome, X-linked; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on MID1

Similar Products

Product Notes

The MID1 mid1 (Catalog #AAA1270259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacac tggagtcaga actgacctgc cctatttgtc tggagctctt tgaggaccct cttctactgc cctgcgcaca cagcctctgc ttcaactgcg cccaccgcat cctagtatca cactgtgcca ccaacgagtc tgtggagtcc atcaccgcct tccagtgccc cacctgccgg catgtcatca ccctcagcca gcgaggtcta gacgggctca agcgcaacgt caccctacag aacatcatcg acaggttcca gaaagcatca gtgagcgggc ccaactctcc cagcgagacc cgtcgggagc gggcctttga cgccaacacc atgacctccg ccgagaaggt cctctgccag ttttgtgacc aggatcctgc ccaggacgct gtgaagacct gtgtcacttg tgaagtatcc tactgtgacg agtgcctgaa agccactcac ccgaataaga agccctttac aggccatcgt ctgattgagc caattccgga ctctcacatc cgggggctga tgtgcttgga gcatgaggat gagaaggtga atatgtactg tgtgaccgat gaccagttaa tctgtgcctt gtgtaaactg gttgggcggc accgcgatca tcaggtggca gctttgagtg agcgctatga caaattgaag caaaacttag agagtaacct caccaacctt attaagagga acacagaact ggagaccctt ttggctaaac tcatccaaac ctgtcaacat gttgaagtca atgcatcacg tcaagaagcc aaattgacag aggagtgtga tcttctcatt gagatcattc agcaaagacg acagattatt ggaaccaaga tcaaagaagg gaaggtgatg aggcttcgca aactggctca gcagattgca aactgcaaac agtgcattga gcggtcagca tcactcatct cccaagcgga acactctctg aaggagaatg atcatgcgcg tttcctacag actgctaaga atatcaccga gagagtctcc atggcaactg catcctccca ggttctaatt cctgaaatca acctcaatga cacatttgac acctttgcct tagatttttc ccgagagaag aaactgctag aatgtctgga ttaccttaca gctcccaacc ctcccacaat tagagaagag ctctgcacag cttcatatga caccatcact gtgcattgga cctccgatga tgagttcagc gtggtctcct acgagctcca gtacaccata ttcaccggac aagccaacgt cgttagtctg tgtaattcgg ctgatagctg gatgatagta cccaacatca agcagaacca ctacacggtg cacggtctgc agagcggcac caagtacatc ttcatggtca aggccatcaa ccaggcgggc agccgcagca gtgagcctgg gaagttgaag acaaacagcc aaccatttaa actggatccc aaatctgctc atcgaaaact gaaggtgtcc catgataact tgacagtaga acgtgatgag tcatcatcca agaagagtca cacacctgaa cgcttcacca gccaggggag ctatggagta gctggaaatg tgtttattga tagtggccgg cattattggg aagtggtcat aagtggaagc acatggtatg ccattggtct tgcttacaaa tcagccccga agcatgaatg gattgggaag aactctgctt cctgggcgct ctgccgctgc aacaataact gggtggtgag acacaatagc aaggaaatcc ccattgagcc tgccccccac ctccggcgcg tgggcatcct gctggactat gataacggct ctatcgcctt ttatgatgct ttgaactcca tccacctcta caccttcgac gtcgcatttg cgcagcctgt ttgccccacc ttcaccgtgt ggaacaagtg tctgacgatt atcactgggc tccctatccc agaccatttg gactgcacag agcagctgcc gtga. It is sometimes possible for the material contained within the vial of "MID1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.