Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA5 cdna clone

SERPINA5 cDNA Clone

Gene Names
SERPINA5; PCI; PAI3; PAI-3; PCI-B; PROCI; PLANH3
Synonyms
SERPINA5; SERPINA5 cDNA Clone; SERPINA5 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagctcttcctcctcttgtgcctggtgcttctcagccctcagggggcctcccttcaccgccaccacccccgggagatgaagaagagagtcgaggacctccatgtaggtgccacggtggcccccagcagcagaagggactttacctttgacctctacagggccttggcttccgctgcccccagccagaacatcttcttctcccctgtgagcatctccatgagcctggccatgctctccctgggggctgggtccagcacaaagatgcagatcctggagggcctgggcctcaacctccagaaaagctcagagaaggagctgcacagaggctttcagcagctccttcaggaactcaaccagcccagagatggcttccagctgagcctcggcaatgcccttttcaccgacctggtggtagacctgcaggacaccttcgtaagtgccatgaagacgctgtacctggcagacactttccccaccaactttagggactctgcaggggccatgaagcagatcaatgattatgtggcaaagcaaacgaagggcaagattgtggacttgcttaagaacctcgatagcaatgcggtcgtgatcatggtgaattacatcttctttaaagctaagtgggagacaagcttcaaccacaaaggcacccaagagcaagacttctacgtgacctcggagactgtggtgcgggtacccatgatgagccgcgaggatcagtatcactacctcctggaccggaacctctcctgcagggtggtgggggtcccctaccaaggcaatgccacggctttgttcattctccccagtgagggaaagatgcagcaggtggagaatggactgagtgagaaaacgctgaggaagtggcttaagatgttcaaaaagaggcagctcgagctttaccttcccaaattctccattgagggctcctatcagctggagaaagtcctccccagtctggggatcagtaacgtcttcacctcccatgctgatctgtccggcatcagcaaccactcaaatatccaggtgtctgagatggtgcacaaagctgtggtggaggtggacgagtcgggaaccagagcagcggcagccacggggacaatcttcactttcaggtcggcccgcctgaactctcagaggctagtgttcaacaggccctttctgatgttcattgtggataacaacatcctcttccttggcaaagtgaaccgcccctga
Sequence Length
1221
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,675 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5, mRNA
NCBI Official Synonym Full Names
serpin family A member 5
NCBI Official Symbol
SERPINA5
NCBI Official Synonym Symbols
PCI; PAI3; PAI-3; PCI-B; PROCI; PLANH3
NCBI Protein Information
plasma serine protease inhibitor
UniProt Protein Name
Plasma serine protease inhibitor
UniProt Gene Name
SERPINA5
UniProt Synonym Gene Names
PCI; PLANH3; PROCI; PAI-3; PAI3; PCI
UniProt Entry Name
IPSP_HUMAN

NCBI Description

The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]

Uniprot Description

SERPINA5: Heparin-dependent serine protease inhibitor acting in body fluids and secretions. Inactivates serine proteases by binding irreversibly to their serine activation site. Involved in the regulation of intravascular and extravascular proteolytic activities. Plays hemostatic roles in the blood plasma. Acts as a procoagulant and proinflammatory factor by inhibiting the anticoagulant activated protein C factor as well as the generation of activated protein C factor by the thrombin/thrombomodulin complex. Acts as an anticoagulant factor by inhibiting blood coagulation factors like prothrombin, factor XI, factor Xa, plasma kallikrein and fibrinolytic enzymes such as tissue- and urinary- type plasminogen activators. In seminal plasma, inactivates several serine proteases implicated in the reproductive system. Inhibits the serpin acrosin; indirectly protects component of the male genital tract from being degraded by excessive released acrosin. Inhibits tissue-and urinary-type plasminogen activator, prostate-specific antigen and kallikrein activities; has a control on the sperm motility and fertilization. Inhibits the activated protein C-catalyzed degradation of SEMG1 and SEMG2; regulates the degradation of semenogelin during the process of transfer of spermatozoa from the male reproductive tract into the female tract. In urine, inhibits urinary-type plasminogen activator and kallikrein activities. Inactivates membrane-anchored serine proteases activities such as MPRSS7 and TMPRSS11E. Inhibits urinary-type plasminogen activator-dependent tumor cell invasion and metastasis. May also play a non-inhibitory role in seminal plasma and urine as an hydrophobic hormone carrier by its binding to retinoic acid. Belongs to the serpin family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 14q32.1

Cellular Component: acrosomal membrane; external side of plasma membrane; extracellular region; extracellular space; membrane; protein complex

Molecular Function: acrosin binding; glycosaminoglycan binding; heparin binding; phosphatidylcholine binding; protease binding; protein binding; retinoic acid binding; serine-type endopeptidase inhibitor activity

Biological Process: blood coagulation; negative regulation of hydrolase activity; spermatogenesis

Research Articles on SERPINA5

Similar Products

Product Notes

The SERPINA5 serpina5 (Catalog #AAA1270194) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagctct tcctcctctt gtgcctggtg cttctcagcc ctcagggggc ctcccttcac cgccaccacc cccgggagat gaagaagaga gtcgaggacc tccatgtagg tgccacggtg gcccccagca gcagaaggga ctttaccttt gacctctaca gggccttggc ttccgctgcc cccagccaga acatcttctt ctcccctgtg agcatctcca tgagcctggc catgctctcc ctgggggctg ggtccagcac aaagatgcag atcctggagg gcctgggcct caacctccag aaaagctcag agaaggagct gcacagaggc tttcagcagc tccttcagga actcaaccag cccagagatg gcttccagct gagcctcggc aatgcccttt tcaccgacct ggtggtagac ctgcaggaca ccttcgtaag tgccatgaag acgctgtacc tggcagacac tttccccacc aactttaggg actctgcagg ggccatgaag cagatcaatg attatgtggc aaagcaaacg aagggcaaga ttgtggactt gcttaagaac ctcgatagca atgcggtcgt gatcatggtg aattacatct tctttaaagc taagtgggag acaagcttca accacaaagg cacccaagag caagacttct acgtgacctc ggagactgtg gtgcgggtac ccatgatgag ccgcgaggat cagtatcact acctcctgga ccggaacctc tcctgcaggg tggtgggggt cccctaccaa ggcaatgcca cggctttgtt cattctcccc agtgagggaa agatgcagca ggtggagaat ggactgagtg agaaaacgct gaggaagtgg cttaagatgt tcaaaaagag gcagctcgag ctttaccttc ccaaattctc cattgagggc tcctatcagc tggagaaagt cctccccagt ctggggatca gtaacgtctt cacctcccat gctgatctgt ccggcatcag caaccactca aatatccagg tgtctgagat ggtgcacaaa gctgtggtgg aggtggacga gtcgggaacc agagcagcgg cagccacggg gacaatcttc actttcaggt cggcccgcct gaactctcag aggctagtgt tcaacaggcc ctttctgatg ttcattgtgg ataacaacat cctcttcctt ggcaaagtga accgcccctg a. It is sometimes possible for the material contained within the vial of "SERPINA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.