CCDC99 cdna clone
CCDC99 cDNA Clone
Gene Names
SPDL1; CCDC99
Synonyms
CCDC99; CCDC99 cDNA Clone; CCDC99 cdna clone
Sequence
atggaggcagatataatcacaaatcttcgatgcaggctcaaagaggctgaagaagagcgactaaaagctgcacagtatggtttacaactagtagagagtcaaaatgaattacagaatcaattggataaatgtcgtaatgaaatgatgaccatgactgagagttatgaacaagaaaaatatacccttcaaagagaagttgaactcaagagtcgaatgttagaaagtttgagctgcgaatgtgaagctattaaacaacaacaaaaaatgcacctggagaaattggaagaacaactaagcagaagccatggacaggaagtgaatgaactaaaaactaagatagaaaaactgaaagtggaattagatgaagccaggcttagtgaaaagcagctgaagcaccaagtagatcatcagaaggaactcctctcttgtaaatcagaggaactgcgcgtaatgtctgaacgtgtgcaggaaagcatgtcttcagagatgctggctcttcaaattgagctgacagaaatggagagtatgaagaccaccctcaaagaagaagtgaatgaactacaatacagacaagaacagctagaacttcttattactaacctaatgcgccaggtagaccggcttaaagaggaaaaagaggagcgagagaaagaagcagtttcttactataatgccctagagaaagctcgtgtagcaaatcaagatcttcaggtacagttggaccaggcactccagcaagccttggatcccaatagtaaaggcaactctttgtttgcagaggtggaagatcgaagggcagcaatggaacgtcagcttatcagtatgaaagtcaagtatcagtcactaaagaagcaaaatgtatttaacagagaacagatgcagagaatgaagttacaaattgccacgttgctacagatgaaagggtctcaaactgaatttgagcagcaggaacggttgcttgccatgttggagcagaagaatggtgaaataaaacatcttttaggtgaaattagaaatctggagaaatttaagaatttatatgacagtatggaatctaagccttcagtcgactctggtactctggaagataacacctattatacagatttacttcagatgaagctggataacttaaacaaagaaattgaaagcactaaaggtgaattgtccatacagcgaatgaaagcattatttgagagccagcgggctctagatattgagcgaaaactttttgcaaatgaaagatgcctccagctttcagaaagtgaaaatatgaaactgagagctaaactagatgaattgaaactaaaatatgaacctgaagagacagttgaagtgcctgtactgaaaaagaggcgtgaggtgctccctgtggatataaccaccgctaaagatgcatgtgtcaacaacagtgctctcgggggagaagtttatcgattaccgcctcagaaagaggagacacagtcctgccctaacagtttagaagataacaacttgcaattagaaaaatcagtttctatacacacaccagtagtcagtctctctcctcacaaaaatctgcccgtggatatgcagctgaagaaggaaaagaaatgtgtgaaactcataggagttcccgctgacgctgaggccttaagtgaaagaagtggaaacacccctaactctcccaggttagctgctgaatcaaagcttcaaacagaagttaaagaaggaaaagaaacttcaagcaaattggaaaaagaaacttgtaagaaatcacaccctattctatatgtgtcttctaaatctactccagagacccagtgccctcaacagtaa
Sequence Length
1818
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,015 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 99, mRNA
NCBI Official Synonym Full Names
spindle apparatus coiled-coil protein 1
NCBI Official Symbol
SPDL1
NCBI Official Synonym Symbols
CCDC99
NCBI Protein Information
protein Spindly
UniProt Protein Name
Protein Spindly
UniProt Gene Name
SPDL1
UniProt Synonym Gene Names
hSpindly
UniProt Entry Name
SPDLY_HUMAN
NCBI Description
This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Uniprot Description
CCDC99: Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment. Belongs to the Spindly family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 5q35.1
Cellular Component: cytosol; nucleus; outer kinetochore of condensed chromosome; spindle pole
Molecular Function: enzyme binding; kinetochore binding; protein binding
Biological Process: establishment of mitotic spindle orientation; mitotic metaphase plate congression; sister chromatid cohesion
Research Articles on CCDC99
Similar Products
Product Notes
The CCDC99 spdl1 (Catalog #AAA1270124) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcag atataatcac aaatcttcga tgcaggctca aagaggctga agaagagcga ctaaaagctg cacagtatgg tttacaacta gtagagagtc aaaatgaatt acagaatcaa ttggataaat gtcgtaatga aatgatgacc atgactgaga gttatgaaca agaaaaatat acccttcaaa gagaagttga actcaagagt cgaatgttag aaagtttgag ctgcgaatgt gaagctatta aacaacaaca aaaaatgcac ctggagaaat tggaagaaca actaagcaga agccatggac aggaagtgaa tgaactaaaa actaagatag aaaaactgaa agtggaatta gatgaagcca ggcttagtga aaagcagctg aagcaccaag tagatcatca gaaggaactc ctctcttgta aatcagagga actgcgcgta atgtctgaac gtgtgcagga aagcatgtct tcagagatgc tggctcttca aattgagctg acagaaatgg agagtatgaa gaccaccctc aaagaagaag tgaatgaact acaatacaga caagaacagc tagaacttct tattactaac ctaatgcgcc aggtagaccg gcttaaagag gaaaaagagg agcgagagaa agaagcagtt tcttactata atgccctaga gaaagctcgt gtagcaaatc aagatcttca ggtacagttg gaccaggcac tccagcaagc cttggatccc aatagtaaag gcaactcttt gtttgcagag gtggaagatc gaagggcagc aatggaacgt cagcttatca gtatgaaagt caagtatcag tcactaaaga agcaaaatgt atttaacaga gaacagatgc agagaatgaa gttacaaatt gccacgttgc tacagatgaa agggtctcaa actgaatttg agcagcagga acggttgctt gccatgttgg agcagaagaa tggtgaaata aaacatcttt taggtgaaat tagaaatctg gagaaattta agaatttata tgacagtatg gaatctaagc cttcagtcga ctctggtact ctggaagata acacctatta tacagattta cttcagatga agctggataa cttaaacaaa gaaattgaaa gcactaaagg tgaattgtcc atacagcgaa tgaaagcatt atttgagagc cagcgggctc tagatattga gcgaaaactt tttgcaaatg aaagatgcct ccagctttca gaaagtgaaa atatgaaact gagagctaaa ctagatgaat tgaaactaaa atatgaacct gaagagacag ttgaagtgcc tgtactgaaa aagaggcgtg aggtgctccc tgtggatata accaccgcta aagatgcatg tgtcaacaac agtgctctcg ggggagaagt ttatcgatta ccgcctcaga aagaggagac acagtcctgc cctaacagtt tagaagataa caacttgcaa ttagaaaaat cagtttctat acacacacca gtagtcagtc tctctcctca caaaaatctg cccgtggata tgcagctgaa gaaggaaaag aaatgtgtga aactcatagg agttcccgct gacgctgagg ccttaagtga aagaagtgga aacaccccta actctcccag gttagctgct gaatcaaagc ttcaaacaga agttaaagaa ggaaaagaaa cttcaagcaa attggaaaaa gaaacttgta agaaatcaca ccctattcta tatgtgtctt ctaaatctac tccagagacc cagtgccctc aacagtaa. It is sometimes possible for the material contained within the vial of "CCDC99, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
