Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL7 cdna clone

CCL7 cDNA Clone

Gene Names
CCL7; FIC; MARC; MCP3; NC28; MCP-3; SCYA6; SCYA7
Synonyms
CCL7; CCL7 cDNA Clone; CCL7 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTCAGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGATTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGCTACAGAAGGACCACCAGTAGCCACTGTCCCCGGGAAGCTGTAATCTTCAAGACCAAACTGGACAAGGAGATCTGTGCTGACCCCACACAGAAGTGGGTCCAGGACTTTATGAAGCACCTGGACAAGAAAACCCAAACTCCAAAGCTTTGA
Sequence Length
300
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,200 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 7, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 7
NCBI Official Symbol
CCL7
NCBI Official Synonym Symbols
FIC; MARC; MCP3; NC28; MCP-3; SCYA6; SCYA7
NCBI Protein Information
C-C motif chemokine 7
UniProt Protein Name
C-C motif chemokine 7
Protein Family
UniProt Gene Name
CCL7
UniProt Synonym Gene Names
MCP3; SCYA6; SCYA7; MCP-3
UniProt Entry Name
CCL7_HUMAN

NCBI Description

This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]

Uniprot Description

CCL7: Chemotactic factor that attracts monocytes and eosinophils, but not neutrophils. Augments monocyte anti-tumor activity. Also induces the release of gelatinase B. This protein can bind heparin. Binds to CCR1, CCR2 and CCR3. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 17q11.2-q12

Cellular Component: extracellular region

Molecular Function: CCR1 chemokine receptor binding; chemokine activity; protein binding

Biological Process: cell-cell signaling; cellular calcium ion homeostasis; chemotaxis; cytoskeleton organization and biogenesis; eosinophil chemotaxis; G-protein coupled receptor protein signaling pathway; inflammatory response; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of cell migration; positive regulation of GTPase activity; positive regulation of inflammatory response; regulation of cell shape; signal transduction

Research Articles on CCL7

Similar Products

Product Notes

The CCL7 ccl7 (Catalog #AAA1269982) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAAGCCT CTGCAGCACT TCTGTGTCTG CTGCTCACAG CAGCTGCTTT CAGCCCCCAG GGGCTTGCTC AGCCAGTTGG GATTAATACT TCAACTACCT GCTGCTACAG ATTTATCAAT AAGAAAATCC CTAAGCAGAG GCTGGAGAGC TACAGAAGGA CCACCAGTAG CCACTGTCCC CGGGAAGCTG TAATCTTCAA GACCAAACTG GACAAGGAGA TCTGTGCTGA CCCCACACAG AAGTGGGTCC AGGACTTTAT GAAGCACCTG GACAAGAAAA CCCAAACTCC AAAGCTTTGA. It is sometimes possible for the material contained within the vial of "CCL7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.