Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UQCRC2 cdna clone

UQCRC2 cDNA Clone

Gene Names
UQCRC2; QCR2; UQCR2; MC3DN5
Synonyms
UQCRC2; UQCRC2 cDNA Clone; UQCRC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctactaaccagagccggctctttctcgagattttattccctcaaagttgcccccaaagttaaagccacagctgcgcctgcaggagcaccgccacaacctcaggaccttgagtttaccaagttaccaaatggcttggtgattgcttctttggaaaactattctcctgtatcaagaattggtttgttcattaaagcaggcagtagatatgaggacttcagcaatttaggaaccacccatttgctgcgtcttacatccagtctgacgacaaaaggagcttcatctttcaagataacccgtggaattgaagcagttggtggcaaattaagtgtgaccgcaacaagggaaaacatggcttatactgtggaatgcctgcggggtgatgttgatattctaatggagttcctgctcaatgtcaccacagcaccagaatttcgtcgttgggaagtagctgaccttcagcctcagctaaagattgacaaagctgtggcctttcagaatccgcagactcatgtcattgaaaatttgcatgcagcagcttaccggaatgccttggctaatcccttgtattgtcctgactataggattggaaaagtgacatcagaggagttacattacttcgttcagaaccatttcacaagtgcaagaatggctttgattggacttggtgtgagtcatcctgttctaaagcaagttgctgaacagtttctcaacatgaggggtgggcttggtttatctggtgcaaaggccaactaccgtggaggtgaaatccgagaacagaatggagacagtcttgtccatgctgcttttgtagcagaaagtgctgtcgcgggaagtgcagaggcaaatgcatttagtgttcttcagcatgtcctcggtgctgggccacatgtcaagaggggcagcaacaccaccagccatctgcaccaggctgttgccaaggcaactcagcagccatttgatgtttctgcatttaatgccagttactcagattctggactctttgggatttatactatctcccaggccacagctgctggagatgttatcaaggctgcctataatcaagtaaaaacaatagctcaaggaaacctttccaacacagatgtccaagctgccaagaacaagctgaaagctggatacctaatgtcagtggagtcttctgagtgtttcctggaagaagtcgggtcccaggctctagttgctggttcttacatgccaccatccacagtccttcagcagattgattcagtggctaatgctgatatcataaatgcggcaaagaagtttgtttctggccagaagtcaatggcagcaagtggaaatttgggacatacaccttttgttgatgagttgtaa
Sequence Length
1362
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,443 Da
NCBI Official Full Name
Homo sapiens ubiquinol-cytochrome c reductase core protein II, mRNA
NCBI Official Synonym Full Names
ubiquinol-cytochrome c reductase core protein II
NCBI Official Symbol
UQCRC2
NCBI Official Synonym Symbols
QCR2; UQCR2; MC3DN5
NCBI Protein Information
cytochrome b-c1 complex subunit 2, mitochondrial
UniProt Protein Name
Cytochrome b-c1 complex subunit 2, mitochondrial
UniProt Gene Name
UQCRC2
UniProt Entry Name
QCR2_HUMAN

NCBI Description

The protein encoded by this gene is located in the mitochondrion, where it is part of the ubiquinol-cytochrome c reductase complex (also known as complex III). This complex constitutes a part of the mitochondrial respiratory chain. Defects in this gene are a cause of mitochondrial complex III deficiency nuclear type 5. [provided by RefSeq, Jul 2015]

Uniprot Description

UQCRC2: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. The core protein 2 is required for the assembly of the complex. Belongs to the peptidase M16 family. UQCRC2/QCR2 subfamily.

Protein type: Oxidoreductase; EC 1.10.2.2; Energy Metabolism - oxidative phosphorylation; Mitochondrial

Chromosomal Location of Human Ortholog: 16p12

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain complex III; mitochondrion; nucleoplasm

Molecular Function: metalloendopeptidase activity; protein binding; zinc ion binding

Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; oxidative phosphorylation; protein processing

Disease: Mitochondrial Complex Iii Deficiency, Nuclear Type 5

Research Articles on UQCRC2

Similar Products

Product Notes

The UQCRC2 uqcrc2 (Catalog #AAA1269905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctac taaccagagc cggctctttc tcgagatttt attccctcaa agttgccccc aaagttaaag ccacagctgc gcctgcagga gcaccgccac aacctcagga ccttgagttt accaagttac caaatggctt ggtgattgct tctttggaaa actattctcc tgtatcaaga attggtttgt tcattaaagc aggcagtaga tatgaggact tcagcaattt aggaaccacc catttgctgc gtcttacatc cagtctgacg acaaaaggag cttcatcttt caagataacc cgtggaattg aagcagttgg tggcaaatta agtgtgaccg caacaaggga aaacatggct tatactgtgg aatgcctgcg gggtgatgtt gatattctaa tggagttcct gctcaatgtc accacagcac cagaatttcg tcgttgggaa gtagctgacc ttcagcctca gctaaagatt gacaaagctg tggcctttca gaatccgcag actcatgtca ttgaaaattt gcatgcagca gcttaccgga atgccttggc taatcccttg tattgtcctg actataggat tggaaaagtg acatcagagg agttacatta cttcgttcag aaccatttca caagtgcaag aatggctttg attggacttg gtgtgagtca tcctgttcta aagcaagttg ctgaacagtt tctcaacatg aggggtgggc ttggtttatc tggtgcaaag gccaactacc gtggaggtga aatccgagaa cagaatggag acagtcttgt ccatgctgct tttgtagcag aaagtgctgt cgcgggaagt gcagaggcaa atgcatttag tgttcttcag catgtcctcg gtgctgggcc acatgtcaag aggggcagca acaccaccag ccatctgcac caggctgttg ccaaggcaac tcagcagcca tttgatgttt ctgcatttaa tgccagttac tcagattctg gactctttgg gatttatact atctcccagg ccacagctgc tggagatgtt atcaaggctg cctataatca agtaaaaaca atagctcaag gaaacctttc caacacagat gtccaagctg ccaagaacaa gctgaaagct ggatacctaa tgtcagtgga gtcttctgag tgtttcctgg aagaagtcgg gtcccaggct ctagttgctg gttcttacat gccaccatcc acagtccttc agcagattga ttcagtggct aatgctgata tcataaatgc ggcaaagaag tttgtttctg gccagaagtc aatggcagca agtggaaatt tgggacatac accttttgtt gatgagttgt aa. It is sometimes possible for the material contained within the vial of "UQCRC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.