Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGEF1 cdna clone

ARHGEF1 cDNA Clone

Gene Names
ARHGEF1; LSC; GEF1; LBCL2; SUB1.5; P115-RHOGEF
Synonyms
ARHGEF1; ARHGEF1 cDNA Clone; ARHGEF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagacttcgcccgaggggcggcctccccaggcccctcccggcctggcctggttcccgtcagcatcatcggggctgaggatgaggattttgagaacgagctggagacaaactcagaagagcaaaacagccagttccagagcctggagcaggtgaagcggcgcccagcccacctcatggccctcctgcagcacgtggccctgcagtttgagccaggacccctggttctccgggtgccggtccctcccaacgtcgcctttgaacttgaccgcactagggctgacctcatctccgaggatgtccagcggcggttcgtgcaggaggtggtgcaaagccagcaggtagccgtgggccggcagctggaggacttccgttccaagcggctcatgggcatgacgccctgggagcaggagctggcccagctggaggcttgggttgggcgggaccgagccagctacgaggcccgggagcggcacgtggcggagcggctgctcatgcacctggaggagatgcaacataccatctctaccgacgaagaaaagagtgctgccgtggtcaacgccattggcctgtacatgcgccaccttggggtgcggaccaagagtggagacaagaagtcggggaggaacttcttccggaaaaaggtgatggggaaccggcggtcggacgagcctgccaagaccaagaaggggctgagcagcatcctggatgccgcccgctggaaccggggagagccccaggttccagattttcgacacctcaaagcagaggttgatgccgagaagccaggtgctacagaccggaagggaggcgtggggatgccctctcgggaccggaatatcggggctcctgggcaggacacccctggagtctctctgcaccctctgtccctggacagcccagaccgggaaccaggtgctgacgcccccctggagctgggggactcatccccgcagggcccaatgagcctggagtccttggcgcccccagagagtaccgacgagggggccgaaaccgagagccccgagcctggagatgagggggagccggggcggtcgggactggagcttgaaccagaagagcctcccggctggcgggaactcgtccccccagacaccctgcacagcctgcccaagagccaggtgaagcggcaggaggtcatcagcgagctgctggtgacagaggcggcccacgtgcgcatgctgcgggtgctgcacgacctcttcttccagcccatggcagaatgcctgttcttccccttggaggagctgcagaacatcttccccagcctggacgagctcatcgaggtgcattccctgttcctcgatcgcctgatgaagcggaggcaggagagtggctacctcatcgaggagatcggagacgtgctgctggcccggtttgatggtgctgagggctcctggttccagaaaatctcctcccgcttctgcagccgccagtcatttgccttagagcagctcaaagccaagcaacgcaaggaccctcggttctgtgccttcgtgcaggaagctgagagccgcccgcggtgccgccgcctgcagctgaaggacatgatccccacggagatgcagcggctgaccaagtaccccctgctcctgcagagcatcgggcagaacacagaagagcccacagaacgggagaaagtggagctggcagccgagtgctgccgggaaattctacaccacgtcaaccaagccgtgcgtgacatggaggacctgctgaggctcaaggactatcagcggcgcctggacttgtcccaccttcggcagagcagcgaccctatgctgagcgagttcaagaacctggacatcaccaagaagaaattggtccacgagggcccactgacgtggcgggtgactaaggacaaggcagtggaggtgcatgtgctgctgctggacgacctgctgctgctgctccagcgccaggacgagcggctgctgctcaagtcccatagccggacactgacgcccacgcccgatggcaagaccatgctgcggcccgtgctgcggctcacctccgccatgacccgcgaggtggccaccgatcacaaagccttctacgtcctttttacctgggaccaggaggcccagatatacgagctggtggcacagactgtgtcggagcggaaaaactggtgtgctctcatcactgagactgccggatccctgaaagtccctgcccctgcctctcgccctaagccccggcccagcccgagcagcacccgagaacccctcctcagcagctctgagaacggcaatggtggccgagagacgtctccagctgatgcccggaccgagagaatcctcagtgacctcctgcccttctgcagaccaggccccgagggccagctcgctgccacggcccttcggaaagtgctgtccctgaagcagcttctgtttccggcggaggaagacaatggggcggggcctcctcgagatggggatggggtcccagggggcggccccctgagcccagcacggacccaggaaatccaggagaacctgctcagcttggaggagaccatgaagcagctggaggagttggaggaggaattttgccgcctgagacccctcctgtctcagcttggggggaactctgtcccccagcctggctgcacttga
Sequence Length
2640
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
105,854 Da
NCBI Official Full Name
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 1, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 1
NCBI Official Symbol
ARHGEF1
NCBI Official Synonym Symbols
LSC; GEF1; LBCL2; SUB1.5; P115-RHOGEF
NCBI Protein Information
rho guanine nucleotide exchange factor 1
UniProt Protein Name
Rho guanine nucleotide exchange factor 1
UniProt Gene Name
ARHGEF1
UniProt Synonym Gene Names
p115-RhoGEF; p115RhoGEF
UniProt Entry Name
ARHG1_HUMAN

NCBI Description

Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]

Uniprot Description

ARHGEF1: Seems to play a role in the regulation of RhoA GTPase by guanine nucleotide-binding alpha-12 (GNA12) and alpha-13 (GNA13) subunits. Acts as GTPase-activating protein (GAP) for GNA12 and GNA13, and as guanine nucleotide exchange factor (GEF) for RhoA GTPase. Activated G alpha 13/GNA13 stimulates the RhoGEF activity through interaction with the RGS-like domain. This GEF activity is inhibited by binding to activated GNA12. Mediates angiotensin-2- induced RhoA activation. Interacts with RHOA, GNA12 and GNA13. Homooligomerizes through the coiled coil region. May interact with CCPG1. Interacts with CTNNAL1. Ubiquitously expressed. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Rac/Rho; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.13

Cellular Component: cytoplasm; cytosol; plasma membrane

Molecular Function: protein binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: cell proliferation; negative regulation of axonogenesis; Rho protein signal transduction

Research Articles on ARHGEF1

Similar Products

Product Notes

The ARHGEF1 arhgef1 (Catalog #AAA1269840) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagact tcgcccgagg ggcggcctcc ccaggcccct cccggcctgg cctggttccc gtcagcatca tcggggctga ggatgaggat tttgagaacg agctggagac aaactcagaa gagcaaaaca gccagttcca gagcctggag caggtgaagc ggcgcccagc ccacctcatg gccctcctgc agcacgtggc cctgcagttt gagccaggac ccctggttct ccgggtgccg gtccctccca acgtcgcctt tgaacttgac cgcactaggg ctgacctcat ctccgaggat gtccagcggc ggttcgtgca ggaggtggtg caaagccagc aggtagccgt gggccggcag ctggaggact tccgttccaa gcggctcatg ggcatgacgc cctgggagca ggagctggcc cagctggagg cttgggttgg gcgggaccga gccagctacg aggcccggga gcggcacgtg gcggagcggc tgctcatgca cctggaggag atgcaacata ccatctctac cgacgaagaa aagagtgctg ccgtggtcaa cgccattggc ctgtacatgc gccaccttgg ggtgcggacc aagagtggag acaagaagtc ggggaggaac ttcttccgga aaaaggtgat ggggaaccgg cggtcggacg agcctgccaa gaccaagaag gggctgagca gcatcctgga tgccgcccgc tggaaccggg gagagcccca ggttccagat tttcgacacc tcaaagcaga ggttgatgcc gagaagccag gtgctacaga ccggaaggga ggcgtgggga tgccctctcg ggaccggaat atcggggctc ctgggcagga cacccctgga gtctctctgc accctctgtc cctggacagc ccagaccggg aaccaggtgc tgacgccccc ctggagctgg gggactcatc cccgcagggc ccaatgagcc tggagtcctt ggcgccccca gagagtaccg acgagggggc cgaaaccgag agccccgagc ctggagatga gggggagccg gggcggtcgg gactggagct tgaaccagaa gagcctcccg gctggcggga actcgtcccc ccagacaccc tgcacagcct gcccaagagc caggtgaagc ggcaggaggt catcagcgag ctgctggtga cagaggcggc ccacgtgcgc atgctgcggg tgctgcacga cctcttcttc cagcccatgg cagaatgcct gttcttcccc ttggaggagc tgcagaacat cttccccagc ctggacgagc tcatcgaggt gcattccctg ttcctcgatc gcctgatgaa gcggaggcag gagagtggct acctcatcga ggagatcgga gacgtgctgc tggcccggtt tgatggtgct gagggctcct ggttccagaa aatctcctcc cgcttctgca gccgccagtc atttgcctta gagcagctca aagccaagca acgcaaggac cctcggttct gtgccttcgt gcaggaagct gagagccgcc cgcggtgccg ccgcctgcag ctgaaggaca tgatccccac ggagatgcag cggctgacca agtaccccct gctcctgcag agcatcgggc agaacacaga agagcccaca gaacgggaga aagtggagct ggcagccgag tgctgccggg aaattctaca ccacgtcaac caagccgtgc gtgacatgga ggacctgctg aggctcaagg actatcagcg gcgcctggac ttgtcccacc ttcggcagag cagcgaccct atgctgagcg agttcaagaa cctggacatc accaagaaga aattggtcca cgagggccca ctgacgtggc gggtgactaa ggacaaggca gtggaggtgc atgtgctgct gctggacgac ctgctgctgc tgctccagcg ccaggacgag cggctgctgc tcaagtccca tagccggaca ctgacgccca cgcccgatgg caagaccatg ctgcggcccg tgctgcggct cacctccgcc atgacccgcg aggtggccac cgatcacaaa gccttctacg tcctttttac ctgggaccag gaggcccaga tatacgagct ggtggcacag actgtgtcgg agcggaaaaa ctggtgtgct ctcatcactg agactgccgg atccctgaaa gtccctgccc ctgcctctcg ccctaagccc cggcccagcc cgagcagcac ccgagaaccc ctcctcagca gctctgagaa cggcaatggt ggccgagaga cgtctccagc tgatgcccgg accgagagaa tcctcagtga cctcctgccc ttctgcagac caggccccga gggccagctc gctgccacgg cccttcggaa agtgctgtcc ctgaagcagc ttctgtttcc ggcggaggaa gacaatgggg cggggcctcc tcgagatggg gatggggtcc cagggggcgg ccccctgagc ccagcacgga cccaggaaat ccaggagaac ctgctcagct tggaggagac catgaagcag ctggaggagt tggaggagga attttgccgc ctgagacccc tcctgtctca gcttgggggg aactctgtcc cccagcctgg ctgcacttga. It is sometimes possible for the material contained within the vial of "ARHGEF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.