SOX5 cdna clone
SOX5 cDNA Clone
Gene Names
SOX5; L-SOX5; LAMSHF; L-SOX5B; L-SOX5F
Synonyms
SOX5; SOX5 cDNA Clone; SOX5 cdna clone
Sequence
atgtcttccaagcgaccagcctctccgtatggggaagcagatggagaggtagccatggtgacaagcagacagaaagtggaagaagaggagagtgacgggctcccagcctttcaccttcccttgcatgtgagttttcccaacaagcctcactctgaggaatttcagccagtttctctgctgacgcaagagacttgtggccataggactcccacttctcagcacaatacaatggaagttgatggcaataaagttatgtcttcatttgccccacacaactcatctacctcacctcagaaggcagaagaaggtgggcgacagagtggcgagtccttgtctagtacagccctgggaactcctgaacggcgcaagggcagtttagctgatgttgttgacaccttgaagcagaggaaaatggaagagctcatcaaaaacgagccggaagaaacccccagtattgaaaaactactctcaaaggactggaaagacaagcttcttgcaatgggatcggggaactttggcgaaataaaagggactcccgagagcttagctgagaaagaaaggcaactcatgggtatgatcaaccagctgaccagcctccgagagcagctgttggctgcccacgatgagcagaagaaactagctgcctctcagattgagaaacagcgtcagcaaatggagctggccaagcagcaacaagaacaaattgcaagacagcagcagcagcttctacagcaacaacacaaaatcaatttgctccagcaacagatccaggttcaaggtcagctgccgccattaatgattcccgtattccctcctgatcaacggacactggctgcagctgcccagcaaggattcctcctccctccaggcttcagctataaggctggatgtagtgacccttaccctgttcagctgatcccaactaccatggcagctgctgccgcagcaacaccaggcttaggcccactccaactgcagcagttatatgctgcccagctagctgcaatgcaggtatctccaggagggaagctgccaggcataccccaaggcaaccttggtgctgctgtatctcctaccagcattcacacagacaagagcacaaacagcccaccacccaaaagcaaggaaaaaacaacactggagagtctgactcagcaactggcagttaaacagaatgaagaaggaaaatttagccatgcaatgatggatttcaatctgagtggagattctgatggaagtgctggagtctcagagtcaagaatttatagggaatcccgagggcgtggtagcaatgaaccccacataaagcgtccaatgaatgccttcatggtgtgggctaaagatgaacggagaaagatccttcaagcctttcctgacatgcacaactccaacatcagcaagatattgggatctcgctggaaagctatgacaaacctagagaaacagccatattatgaggagcaagcccgtctcagcaagcagcacctggagaagtaccctgactataagtacaagcccaggccaaagcgcacctgcctggtggatggcaaaaagctgcgcattggtgaatacaaggcaatcatgcgcaacaggcggcaggaaatgcggcagtacttcaatgttgggcaacaagcacagatccccattgccactgctggtgttgtgtaccctggagccatcgccatggctgggatgccctcccctcacctgccctcggagcactcaagcgtgtctagcagcccagagcctgggatgcctgttatccagagcacttacggtgtgaaaggagaggagccacatatcaaagaagagatacaggccgaggacatcaatggagaaatttatgatgagtacgacgaggaagaggatgatccagatgtagattatgggagtgacagtgaaaaccatattgcaggacaagccaactga
Sequence Length
1929
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,770 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 5, mRNA
NCBI Official Synonym Full Names
SRY-box 5
NCBI Official Symbol
SOX5
NCBI Official Synonym Symbols
L-SOX5; LAMSHF; L-SOX5B; L-SOX5F
NCBI Protein Information
transcription factor SOX-5
UniProt Protein Name
Transcription factor SOX-5
Protein Family
UniProt Gene Name
SOX5
UniProt Entry Name
SOX5_HUMAN
NCBI Description
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
SOX5: Binds specifically to the DNA sequence 5'-AACAAT-3'. Activates transcription of COL2A1 and AGC1 in vitro. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; DNA-binding
Chromosomal Location of Human Ortholog: 12p12.1
Molecular Function: protein binding; transcription factor activity
Biological Process: asymmetric neuroblast division; positive regulation of chondrocyte differentiation; transcription from RNA polymerase II promoter
Disease: Lamb-shaffer Syndrome
Research Articles on SOX5
Similar Products
Product Notes
The SOX5 sox5 (Catalog #AAA1269831) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttcca agcgaccagc ctctccgtat ggggaagcag atggagaggt agccatggtg acaagcagac agaaagtgga agaagaggag agtgacgggc tcccagcctt tcaccttccc ttgcatgtga gttttcccaa caagcctcac tctgaggaat ttcagccagt ttctctgctg acgcaagaga cttgtggcca taggactccc acttctcagc acaatacaat ggaagttgat ggcaataaag ttatgtcttc atttgcccca cacaactcat ctacctcacc tcagaaggca gaagaaggtg ggcgacagag tggcgagtcc ttgtctagta cagccctggg aactcctgaa cggcgcaagg gcagtttagc tgatgttgtt gacaccttga agcagaggaa aatggaagag ctcatcaaaa acgagccgga agaaaccccc agtattgaaa aactactctc aaaggactgg aaagacaagc ttcttgcaat gggatcgggg aactttggcg aaataaaagg gactcccgag agcttagctg agaaagaaag gcaactcatg ggtatgatca accagctgac cagcctccga gagcagctgt tggctgccca cgatgagcag aagaaactag ctgcctctca gattgagaaa cagcgtcagc aaatggagct ggccaagcag caacaagaac aaattgcaag acagcagcag cagcttctac agcaacaaca caaaatcaat ttgctccagc aacagatcca ggttcaaggt cagctgccgc cattaatgat tcccgtattc cctcctgatc aacggacact ggctgcagct gcccagcaag gattcctcct ccctccaggc ttcagctata aggctggatg tagtgaccct taccctgttc agctgatccc aactaccatg gcagctgctg ccgcagcaac accaggctta ggcccactcc aactgcagca gttatatgct gcccagctag ctgcaatgca ggtatctcca ggagggaagc tgccaggcat accccaaggc aaccttggtg ctgctgtatc tcctaccagc attcacacag acaagagcac aaacagccca ccacccaaaa gcaaggaaaa aacaacactg gagagtctga ctcagcaact ggcagttaaa cagaatgaag aaggaaaatt tagccatgca atgatggatt tcaatctgag tggagattct gatggaagtg ctggagtctc agagtcaaga atttataggg aatcccgagg gcgtggtagc aatgaacccc acataaagcg tccaatgaat gccttcatgg tgtgggctaa agatgaacgg agaaagatcc ttcaagcctt tcctgacatg cacaactcca acatcagcaa gatattggga tctcgctgga aagctatgac aaacctagag aaacagccat attatgagga gcaagcccgt ctcagcaagc agcacctgga gaagtaccct gactataagt acaagcccag gccaaagcgc acctgcctgg tggatggcaa aaagctgcgc attggtgaat acaaggcaat catgcgcaac aggcggcagg aaatgcggca gtacttcaat gttgggcaac aagcacagat ccccattgcc actgctggtg ttgtgtaccc tggagccatc gccatggctg ggatgccctc ccctcacctg ccctcggagc actcaagcgt gtctagcagc ccagagcctg ggatgcctgt tatccagagc acttacggtg tgaaaggaga ggagccacat atcaaagaag agatacaggc cgaggacatc aatggagaaa tttatgatga gtacgacgag gaagaggatg atccagatgt agattatggg agtgacagtg aaaaccatat tgcaggacaa gccaactga. It is sometimes possible for the material contained within the vial of "SOX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
