Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMC6 cdna clone

PSMC6 cDNA Clone

Gene Names
PSMC6; P44; p42; SUG2; CADP44; HEL-S-73
Synonyms
PSMC6; PSMC6 cDNA Clone; PSMC6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaccctagagataaggcgcttcaggactaccgcaagaagttgcttgaacacaaggagatcgacggccgtcttaaggagttaagggaacaattaaaagaacttaccaagcagtatgaaaagtctgaaaatgatctgaaggccctacagagtgttgggcagatcgtgggtgaagtgcttaaacagttaactgaagaaaaattcattgttaaagctaccaatggaccaagatatgttgtgggttgtcgtcgacagcttgacaaaagtaagctgaagccaggaacaagagttgctttggatatgactacactaactatcatgagatatttgccgagagaggtggatccactggtttataacatgtctcatgaggaccctgggaatgtttcttattctgagattggagggctatcagaacagatccgggaattaagagaggtgatagaattacctcttacaaacccagagttatttcagcgtgtaggaataatacctccaaaaggctgtttgttatatggaccaccaggtacgggaaaaacactcttggcacgagccgttgctagccagctggactgcaatttcttaaaggttgtatctagttctattgtagacaagtacattggtgaaagtgctcgtttgatcagagaaatgtttaattatgctagagatcatcaaccatgcatcatttttatggatgaaatagatgctattggtggtcgtcggttttctgagggtacttcagctgacagagagattcagagaacgttaatggagttactgaatcaaatggatggatttgatactctgcatagagttaaaatgatcatggctacaaacagaccagatacactggatcctgctttgctgcgtccaggaagattagatagaaaaatacatattgatttgccaaatgaacaagcaagattagacatactgaaaatccatgcaggtcccattacaaagcatggtgaaatagattatgaagcaattgtgaagctttcggatggctttaatggagcagatctgagaaatgtttgtactgaagcaggtatgttcgcaattcgtgctgatcatgattttgtagtacaggaagacttcatgaaagcagtcagaaaagtggctgattctaagaagctggagtctaaattggactacaaacctgtgtaa
Sequence Length
1170
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,173 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, ATPase 6
NCBI Official Symbol
PSMC6
NCBI Official Synonym Symbols
P44; p42; SUG2; CADP44; HEL-S-73
NCBI Protein Information
26S protease regulatory subunit 10B
UniProt Protein Name
26S protease regulatory subunit 10B
Protein Family
UniProt Gene Name
PSMC6
UniProt Synonym Gene Names
SUG2
UniProt Entry Name
PRS10_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008]

Uniprot Description

RPT4: The 26S protease is involved in the ATP-dependent degradation of ubiquitinated proteins. The regulatory (or ATPase) complex confers ATP dependency and substrate specificity to the 26S complex. Belongs to the AAA ATPase family.

Protein type: Proteasome complex; Protease

Chromosomal Location of Human Ortholog: 14q22.1

Cellular Component: cytosol; membrane; nucleoplasm; nucleus; proteasome complex

Molecular Function: ATPase activity; protein binding; TATA-binding protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; ER-associated protein catabolic process; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of transcriptional preinitiation complex assembly; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMC6

Similar Products

Product Notes

The PSMC6 psmc6 (Catalog #AAA1269752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacc ctagagataa ggcgcttcag gactaccgca agaagttgct tgaacacaag gagatcgacg gccgtcttaa ggagttaagg gaacaattaa aagaacttac caagcagtat gaaaagtctg aaaatgatct gaaggcccta cagagtgttg ggcagatcgt gggtgaagtg cttaaacagt taactgaaga aaaattcatt gttaaagcta ccaatggacc aagatatgtt gtgggttgtc gtcgacagct tgacaaaagt aagctgaagc caggaacaag agttgctttg gatatgacta cactaactat catgagatat ttgccgagag aggtggatcc actggtttat aacatgtctc atgaggaccc tgggaatgtt tcttattctg agattggagg gctatcagaa cagatccggg aattaagaga ggtgatagaa ttacctctta caaacccaga gttatttcag cgtgtaggaa taatacctcc aaaaggctgt ttgttatatg gaccaccagg tacgggaaaa acactcttgg cacgagccgt tgctagccag ctggactgca atttcttaaa ggttgtatct agttctattg tagacaagta cattggtgaa agtgctcgtt tgatcagaga aatgtttaat tatgctagag atcatcaacc atgcatcatt tttatggatg aaatagatgc tattggtggt cgtcggtttt ctgagggtac ttcagctgac agagagattc agagaacgtt aatggagtta ctgaatcaaa tggatggatt tgatactctg catagagtta aaatgatcat ggctacaaac agaccagata cactggatcc tgctttgctg cgtccaggaa gattagatag aaaaatacat attgatttgc caaatgaaca agcaagatta gacatactga aaatccatgc aggtcccatt acaaagcatg gtgaaataga ttatgaagca attgtgaagc tttcggatgg ctttaatgga gcagatctga gaaatgtttg tactgaagca ggtatgttcg caattcgtgc tgatcatgat tttgtagtac aggaagactt catgaaagca gtcagaaaag tggctgattc taagaagctg gagtctaaat tggactacaa acctgtgtaa. It is sometimes possible for the material contained within the vial of "PSMC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.