Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTC19 cdna clone

TTC19 cDNA Clone

Gene Names
TTC19; MC3DN2; 2010204O13Rik
Synonyms
TTC19; TTC19 cDNA Clone; TTC19 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagatgagccagaagaggctgagttaattttgcatgacgctcttcgtctcgcctatcagactgataacaagaaggccatcacttacacttatgatttgatggccaacttagcatttatacggggtcagcttgaaaatgctgaacaactttttaaagcaacaatgagttacctccttggagggggcatgaagcaggaggacaatgcaataattgaaatttccctaaagctggccagtatctatgctgcgcagaacagacaggaatttgctgttgctggctatgaattctgcatttcaactctagaggaaaaaattgaaagagaaaaggaattagcagaagacattatgtcagtggaagagaaagccaatacccacctcctcttgggcatgtgcttagacgcctgtgctcgctaccttctgttctccaagcagccgtcacaggcacaaaggatgtatgaaaaagctctgcagatttctgaagaaatacaaggagaaagacacccacagaccattgtgctgatgagtgacctggctactaccctggatgcacagggccgctttgatgaggcctatatttatatgcaaagggcatcagatctggcaagacagataaatcatcctgagctacacatggtactcagtaatctagctgcagttttgatgcacagagaacgatatacacaagcaaaagagatctaccaggaagcactgaagcaagcaaagctgaaaaaagatgaaatttctgtacaacacatcagggaagagttggctgagctgtcaaagaaaagtagacctttgacaaattctgtcaagctctaa
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,457 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 19, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 19
NCBI Official Symbol
TTC19
NCBI Official Synonym Symbols
MC3DN2; 2010204O13Rik
NCBI Protein Information
tetratricopeptide repeat protein 19, mitochondrial
UniProt Protein Name
Tetratricopeptide repeat protein 19, mitochondrial
UniProt Gene Name
TTC19
UniProt Synonym Gene Names
TPR repeat protein 19
UniProt Entry Name
TTC19_HUMAN

NCBI Description

This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]

Uniprot Description

TTC19: Mitochondrial protein required for formation of the mitochondrial complex III (PubMed:21278747). May also be required for the abcission step in cytokinesis, possibly regulating the ESCRT-III complex via its interaction with CHMP4B (PubMed:20208530). However, the involvement in cytokinesis requires additional experimental evidence. Defects in TTC19 are a cause of mitochondrial complex III deficiency (MT-C3D). A disorder of the mitochondrial respiratory chain resulting in a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance. Belongs to the TTC19 family.

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 17p12

Cellular Component: centrosome; midbody; mitochondrial inner membrane; mitochondrion

Molecular Function: protein binding

Biological Process: cytokinesis

Disease: Mitochondrial Complex Iii Deficiency, Nuclear Type 2

Research Articles on TTC19

Similar Products

Product Notes

The TTC19 ttc19 (Catalog #AAA1269748) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagatg agccagaaga ggctgagtta attttgcatg acgctcttcg tctcgcctat cagactgata acaagaaggc catcacttac acttatgatt tgatggccaa cttagcattt atacggggtc agcttgaaaa tgctgaacaa ctttttaaag caacaatgag ttacctcctt ggagggggca tgaagcagga ggacaatgca ataattgaaa tttccctaaa gctggccagt atctatgctg cgcagaacag acaggaattt gctgttgctg gctatgaatt ctgcatttca actctagagg aaaaaattga aagagaaaag gaattagcag aagacattat gtcagtggaa gagaaagcca atacccacct cctcttgggc atgtgcttag acgcctgtgc tcgctacctt ctgttctcca agcagccgtc acaggcacaa aggatgtatg aaaaagctct gcagatttct gaagaaatac aaggagaaag acacccacag accattgtgc tgatgagtga cctggctact accctggatg cacagggccg ctttgatgag gcctatattt atatgcaaag ggcatcagat ctggcaagac agataaatca tcctgagcta cacatggtac tcagtaatct agctgcagtt ttgatgcaca gagaacgata tacacaagca aaagagatct accaggaagc actgaagcaa gcaaagctga aaaaagatga aatttctgta caacacatca gggaagagtt ggctgagctg tcaaagaaaa gtagaccttt gacaaattct gtcaagctct aa. It is sometimes possible for the material contained within the vial of "TTC19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.