Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETDB2 cdna clone

SETDB2 cDNA Clone

Gene Names
SETDB2; CLLD8; CLLL8; KMT1F; C13orf4
Synonyms
SETDB2; SETDB2 cDNA Clone; SETDB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagaaaaaaatggcgatgcaaaaactttctggatggagctagaagatgatggaaaagtggacttcatttttgaacaagtacaaaatgtgctgcagtcactgaaacaaaagatcaaagatgggtctgccaccaataaagaatacatccaagcaatgattctagtgaatgaagcaactataattaacagttcaacatcaataaaggatcctatgcctgtgactcagaaggaacaggaaaacaaatccaatgcatttccctctacatcatgtgaaaactcctttccagaagactgtacatttctaacaacaggaaataaggaaattctctctcttgaagataaagttgtagactttagagaaaaagactcatcttcgaatttatcttaccaaagtcatgactgctctggtgcttgtctgatgaaaatgccactgaacttgaagggagaaaaccctctgcagctgccaatcaaatgtcacttccaaagacgacatgcaaagacaaactctcattcttcagcactccacgtgagttataaaaccccttgtggaaggagtctacgaaacgtggaggaagtttttcgttacctgcttgagacagagtgtaactttttatttacagataacttttctttcaatacctatgttcagttggctcggaattacccaaagcaaaaagaagttgtttctgatgtggatattagcaatggagtggaatcagtgcccatttctttctgtaatgaaattgacagtagaaagctcccacagtttaagtacagaaagactgtgtggcctcgagcatataatctaaccaacttttccagcatgtttactgattcctgtgactgctctgagggctgcatagacataacaaaatgtgcatgtcttcaactgacagcaaggaatgccaaaacttcccccttgtcaagtgacaaaataaccactggatataaatataaaagactacagagacagattcctactggcatttatgaatgcagccttttgtgcaaatgtaatcgacaattgtgtcaaaaccgagttgtccaacatggtcctcaagtgaggttacaggtgttcaaaactgagcagaagggatggggtgtacgctgtctagatgacattgacagagggacatttgtttgcatttattcaggaagattactaagcagagctaacactgaaaaatcttatggtattgatgaaaacgggagagatgagaatactatgaaaaatatattttcaaaaaagaggaaattagaagttgcatgttcagattgtgaagttgaagttctcccattaggattggaaacacatcctagaactgctaaaactgagaaatgtccaccaaagttcagtaataatcccaaggagcttactatggaaacgaaatatgataatatttcaagaattcagtatcattcagttattagagatcctgaatccaagacagccatttttcaacacaatgggaaaaaaatggaatttgtttcctcggagtctgtcactccagaagataatgatggatttaaaccaccccgagagcatctgaactctaaaaccaagggagcacaaaaggactcaagttcaaaccatgttgatgagtttgaagataatctgctgattgaatcagatgtgatagatataactaaatatagagaagaaactccaccaaggagcagatgtaaccaggcgaccacattggataatcagaatattaaaaaggcaattgaggttcaaattcagaaaccccaagagggacgatctacagcatgtcaaagacagcaggtattttgtgatgaagagttgctaagtgaaaccaagaatacttcatctgattctctaacaaagttcaataaagggaatgtgtttttattggatgccacaaaagaaggaaatgtcggccgcttccttaatcatagttgttgcccaaatctcttggtacagaatgtttttgtagaaacacacaacaggaattttccattggtggcattcttcaccaacaggtatgtgaaagcaagaacagagctaacatgggattatggctatgaagctgggactgtgcctgagaaggaaatcttctgccaatgtggggttaataaatgtagaaaaaaaatattataa
Sequence Length
2124
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,766 Da
NCBI Official Full Name
Homo sapiens SET domain, bifurcated 2, mRNA
NCBI Official Synonym Full Names
SET domain bifurcated 2
NCBI Official Symbol
SETDB2
NCBI Official Synonym Symbols
CLLD8; CLLL8; KMT1F; C13orf4
NCBI Protein Information
histone-lysine N-methyltransferase SETDB2
UniProt Protein Name
Histone-lysine N-methyltransferase SETDB2
UniProt Gene Name
SETDB2
UniProt Synonym Gene Names
C13orf4; CLLD8; KMT1F
UniProt Entry Name
SETB2_HUMAN

NCBI Description

This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

SETDB2: Histone methyltransferase involved in left-right axis specification in early development and mitosis. Specifically trimethylates 'Lys-9' of histone H3 (H3K9me3). H3K9me3 is a specific tag for epigenetic transcriptional repression that recruits HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Contributes to H3K9me3 in both the interspersed repetitive elements and centromere-associated repeats. Plays a role in chromosome condensation and segregation during mitosis. Belongs to the histone-lysine methyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.1.1.43; Amino Acid Metabolism - lysine degradation; Methyltransferase; Methyltransferase, protein lysine

Chromosomal Location of Human Ortholog: 13q14

Cellular Component: nucleoplasm; nucleus

Molecular Function: histone lysine N-methyltransferase activity (H3-K9 specific); histone-lysine N-methyltransferase activity; protein binding

Biological Process: chromosome segregation; heart looping; histone H3-K9 methylation; mitosis; negative regulation of transcription, DNA-dependent

Research Articles on SETDB2

Similar Products

Product Notes

The SETDB2 setdb2 (Catalog #AAA1269570) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagaaa aaaatggcga tgcaaaaact ttctggatgg agctagaaga tgatggaaaa gtggacttca tttttgaaca agtacaaaat gtgctgcagt cactgaaaca aaagatcaaa gatgggtctg ccaccaataa agaatacatc caagcaatga ttctagtgaa tgaagcaact ataattaaca gttcaacatc aataaaggat cctatgcctg tgactcagaa ggaacaggaa aacaaatcca atgcatttcc ctctacatca tgtgaaaact cctttccaga agactgtaca tttctaacaa caggaaataa ggaaattctc tctcttgaag ataaagttgt agactttaga gaaaaagact catcttcgaa tttatcttac caaagtcatg actgctctgg tgcttgtctg atgaaaatgc cactgaactt gaagggagaa aaccctctgc agctgccaat caaatgtcac ttccaaagac gacatgcaaa gacaaactct cattcttcag cactccacgt gagttataaa accccttgtg gaaggagtct acgaaacgtg gaggaagttt ttcgttacct gcttgagaca gagtgtaact ttttatttac agataacttt tctttcaata cctatgttca gttggctcgg aattacccaa agcaaaaaga agttgtttct gatgtggata ttagcaatgg agtggaatca gtgcccattt ctttctgtaa tgaaattgac agtagaaagc tcccacagtt taagtacaga aagactgtgt ggcctcgagc atataatcta accaactttt ccagcatgtt tactgattcc tgtgactgct ctgagggctg catagacata acaaaatgtg catgtcttca actgacagca aggaatgcca aaacttcccc cttgtcaagt gacaaaataa ccactggata taaatataaa agactacaga gacagattcc tactggcatt tatgaatgca gccttttgtg caaatgtaat cgacaattgt gtcaaaaccg agttgtccaa catggtcctc aagtgaggtt acaggtgttc aaaactgagc agaagggatg gggtgtacgc tgtctagatg acattgacag agggacattt gtttgcattt attcaggaag attactaagc agagctaaca ctgaaaaatc ttatggtatt gatgaaaacg ggagagatga gaatactatg aaaaatatat tttcaaaaaa gaggaaatta gaagttgcat gttcagattg tgaagttgaa gttctcccat taggattgga aacacatcct agaactgcta aaactgagaa atgtccacca aagttcagta ataatcccaa ggagcttact atggaaacga aatatgataa tatttcaaga attcagtatc attcagttat tagagatcct gaatccaaga cagccatttt tcaacacaat gggaaaaaaa tggaatttgt ttcctcggag tctgtcactc cagaagataa tgatggattt aaaccacccc gagagcatct gaactctaaa accaagggag cacaaaagga ctcaagttca aaccatgttg atgagtttga agataatctg ctgattgaat cagatgtgat agatataact aaatatagag aagaaactcc accaaggagc agatgtaacc aggcgaccac attggataat cagaatatta aaaaggcaat tgaggttcaa attcagaaac cccaagaggg acgatctaca gcatgtcaaa gacagcaggt attttgtgat gaagagttgc taagtgaaac caagaatact tcatctgatt ctctaacaaa gttcaataaa gggaatgtgt ttttattgga tgccacaaaa gaaggaaatg tcggccgctt ccttaatcat agttgttgcc caaatctctt ggtacagaat gtttttgtag aaacacacaa caggaatttt ccattggtgg cattcttcac caacaggtat gtgaaagcaa gaacagagct aacatgggat tatggctatg aagctgggac tgtgcctgag aaggaaatct tctgccaatg tggggttaat aaatgtagaa aaaaaatatt ataa. It is sometimes possible for the material contained within the vial of "SETDB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.