Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NEIL2 cdna clone

NEIL2 cDNA Clone

Gene Names
NEIL2; NEH2; NEI2
Synonyms
NEIL2; NEIL2 cDNA Clone; NEIL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagaagggccgttggtgaggaaatttcaccatttggtctccccctttgtgggtcagcaggtggtcaagacagggggcagcagtaagaagctacagcccgccagcctgcagtctctgtggctccaggacacccaggtccatggaaagaaattattccttagatttgatctagatgaagaaatggggccccctggcagcagcccaacaccagagcctccacaaaaagaagtgcagaaggaaggggctgcggacccaaagcaggtcggggagcccagcgggcagaagacccttgatggatcctcacggtctgcagagctcgtcccccagggcgaggatgattctgagtatttggagagagacgcccctgcaggagatgctgggaggtggctgcgtgtcagctttggtttgtttggcagcgtttgggtgaacgatttctccagagccaagaaagccaacaagaggggggactggagggacccttccccgaggttggtcctgcactttggtggtggtggcttcctggcattttataattgtcagttgtcttggagctcttccccggtggtcacacccacctgtgacatcctgtctgagaagttccatcgaggacaagccttagaagctctaggccaggctcagcctgtctgctatacactgctggaccagagatacttctcagggctagggaacatcattaagaatgaagccttgtacagagctgggatccatcccctttctctcggttcagtcctgagtgcctcgcgtcgggaggtcctggtggatcacgtggtggagttcagtacagcctggctgcagggcaagttccaaggcagaccgcagcacacacaggtctaccagaaagaacagtgccctgctggccaccaggtcatgaaggaggcgtttgggcccgaagatgggttacagaggctcacctggtggtgcccgcagtgccagccccagttgtcagaggagccagagcagtgccagttctcctaa
Sequence Length
999
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,136 Da
NCBI Official Full Name
Homo sapiens nei like 2 (E. coli), mRNA
NCBI Official Synonym Full Names
nei like DNA glycosylase 2
NCBI Official Symbol
NEIL2
NCBI Official Synonym Symbols
NEH2; NEI2
NCBI Protein Information
endonuclease 8-like 2
UniProt Protein Name
Endonuclease 8-like 2
Protein Family
UniProt Gene Name
NEIL2
UniProt Synonym Gene Names
NEH2
UniProt Entry Name
NEIL2_HUMAN

NCBI Description

NEIL2 belongs to a class of DNA glycosylases homologous to the bacterial Fpg/Nei family. These glycosylases initiate the first step in base excision repair by cleaving bases damaged by reactive oxygen species and introducing a DNA strand break via the associated lyase reaction (Bandaru et al., 2002 [PubMed 12509226])[supplied by OMIM, Mar 2008]

Uniprot Description

NEIL2: Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Has DNA glycosylase activity towards 5-hydroxyuracil and other oxidized derivatives of cytosine with a preference for mismatched double stranded DNA (DNA bubbles). Has low or no DNA glycosylase activity towards thymine glycol, 2-hydroxyadenine, hypoxanthine and 8-oxoguanine. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. Belongs to the FPG family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Microtubule-binding; DNA repair, damage; Lyase; EC 4.2.99.18; Hydrolase

Chromosomal Location of Human Ortholog: 8p23.1

Cellular Component: nucleoplasm

Molecular Function: DNA N-glycosylase activity; protein binding

Biological Process: depyrimidination

Research Articles on NEIL2

Similar Products

Product Notes

The NEIL2 neil2 (Catalog #AAA1269548) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagaag ggccgttggt gaggaaattt caccatttgg tctccccctt tgtgggtcag caggtggtca agacaggggg cagcagtaag aagctacagc ccgccagcct gcagtctctg tggctccagg acacccaggt ccatggaaag aaattattcc ttagatttga tctagatgaa gaaatggggc cccctggcag cagcccaaca ccagagcctc cacaaaaaga agtgcagaag gaaggggctg cggacccaaa gcaggtcggg gagcccagcg ggcagaagac ccttgatgga tcctcacggt ctgcagagct cgtcccccag ggcgaggatg attctgagta tttggagaga gacgcccctg caggagatgc tgggaggtgg ctgcgtgtca gctttggttt gtttggcagc gtttgggtga acgatttctc cagagccaag aaagccaaca agagggggga ctggagggac ccttccccga ggttggtcct gcactttggt ggtggtggct tcctggcatt ttataattgt cagttgtctt ggagctcttc cccggtggtc acacccacct gtgacatcct gtctgagaag ttccatcgag gacaagcctt agaagctcta ggccaggctc agcctgtctg ctatacactg ctggaccaga gatacttctc agggctaggg aacatcatta agaatgaagc cttgtacaga gctgggatcc atcccctttc tctcggttca gtcctgagtg cctcgcgtcg ggaggtcctg gtggatcacg tggtggagtt cagtacagcc tggctgcagg gcaagttcca aggcagaccg cagcacacac aggtctacca gaaagaacag tgccctgctg gccaccaggt catgaaggag gcgtttgggc ccgaagatgg gttacagagg ctcacctggt ggtgcccgca gtgccagccc cagttgtcag aggagccaga gcagtgccag ttctcctaa. It is sometimes possible for the material contained within the vial of "NEIL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.