Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAC3 cdna clone

RAC3 cDNA Clone

Synonyms
RAC3; RAC3 cDNA Clone; RAC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccatcaagtgcgtggtggtcggcgacggcgccgtggggaagacatgcttgctgatcagctacacgaccaacgccttccccggagagtacatccccaccgtttttgacaactactctgccaacgtgatggtggacgggaaaccagtcaacttggggctgtgggacacagcgggtcaggaggactacgatcggctgcggccactctcctacccccaaactgacgtctttctgatctgcttctctctggtgagcccggcctccttcgagaatgttcgtgccaagtggtacccggaggtgcggcaccactgcccccacacgcccatcctcctggtgggcaccaagctggacctccgcgacgacaaggacaccattgagcggctgcgggacaagaagctggcacccatcacctacccacagggcctggccatggcccgggagattggctctgtgaaatacctggagtgctcagccctgacccagcggggcctgaagacagtgtttgacgaggcgatccgcgcggtgctctgcccgcccccagtgaagaagccggggaagaagtgcaccgtcttctag
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,379 Da
NCBI Official Full Name
Homo sapiens ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3), mRNA
NCBI Official Synonym Full Names
ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)
NCBI Official Symbol
RAC3
NCBI Protein Information
ras-related C3 botulinum toxin substrate 3
UniProt Protein Name
Ras-related C3 botulinum toxin substrate 3
UniProt Gene Name
RAC3
UniProt Entry Name
RAC3_HUMAN

NCBI Description

The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]

Research Articles on RAC3

Similar Products

Product Notes

The RAC3 rac3 (Catalog #AAA1269544) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcca tcaagtgcgt ggtggtcggc gacggcgccg tggggaagac atgcttgctg atcagctaca cgaccaacgc cttccccgga gagtacatcc ccaccgtttt tgacaactac tctgccaacg tgatggtgga cgggaaacca gtcaacttgg ggctgtggga cacagcgggt caggaggact acgatcggct gcggccactc tcctaccccc aaactgacgt ctttctgatc tgcttctctc tggtgagccc ggcctccttc gagaatgttc gtgccaagtg gtacccggag gtgcggcacc actgccccca cacgcccatc ctcctggtgg gcaccaagct ggacctccgc gacgacaagg acaccattga gcggctgcgg gacaagaagc tggcacccat cacctaccca cagggcctgg ccatggcccg ggagattggc tctgtgaaat acctggagtg ctcagccctg acccagcggg gcctgaagac agtgtttgac gaggcgatcc gcgcggtgct ctgcccgccc ccagtgaaga agccggggaa gaagtgcacc gtcttctag. It is sometimes possible for the material contained within the vial of "RAC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.