Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC61A2 cdna clone

SEC61A2 cDNA Clone

Synonyms
SEC61A2; SEC61A2 cDNA Clone; SEC61A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcatcaaatttttagaagttatcaaaccattctgtgcagttctaccagaaattcagaaaccggaaaggaaaatccagtttagagagaaggttctgtggactgctataacgctcttcattttcttagtgtgttgtcagatcccactgtttggaatcatgtcatcagattctgcagatcctttctactggatgagagttattctggcttccaatagaggaactttaatggaattgggtatctccccaattgtaacatctggtttgattatgcagttgttagctggagccaaaatcattgaagttggagatacaccgaaagatagagctttattcaatggagcccagaaactgtttggtatgatcattaccattgggcaagccattgtgtatgtcatgacggggatgtatggggaccctgcagaaatgggtgctggaatctgtctcctgatcatcattcagttgtttgttgctggtttgattgtgctgctgttagatgagctgctacagaagggttacggcttggggtctgggatttccctctttattgccaccaacatctgtgagaccattgtctggaaggcctttagtcccactaccattaacactggcagaggtactgagtttgagggtgcagtcatagctctgttccatttgttggccaccaggacggacaaagtccgagctttacgggaggctttttatcggcagaacttacccaatctcatgaacctcattgctacagtttttgtgtttgctgttgttatatatttccaaggatttcgcgttgatctgcccattaagtcggcccgttaccgaggacagtacagcagctaccccatcaaactcttctacacctccaacatccccatcatcctccagtcggccctggtgtccaacctgtatgttatttcccagatgctgtctgttcgatttagtggcaactttttagtaaatttactaggacagtgggccgatgtcagtgggggaggacccgcacgttcttacccagttggaggcctttgttactatctttctcctcctgagtccatgggcgccatctttgaggatcctgtccatgtcgttgtttatatcatcttcatgttggggtcatgtgcattcttctctaagacatggattgaagtgtctggttcctcagccaaagatgtagctaaacagctgaaagaacagcagatggtaatgaggggccaccgagatacctctatggttcatgagcttaatagcgctagagcgtag
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,593 Da
NCBI Official Full Name
Homo sapiens Sec61 alpha 2 subunit (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
Sec61 translocon alpha 2 subunit
NCBI Official Symbol
SEC61A2
NCBI Protein Information
protein transport protein Sec61 subunit alpha isoform 2
UniProt Protein Name
Protein transport protein Sec61 subunit alpha isoform 2
Protein Family
UniProt Gene Name
SEC61A2
UniProt Synonym Gene Names
Sec61 alpha-2
UniProt Entry Name
S61A2_HUMAN

NCBI Description

The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]

Uniprot Description

SEC61A2: Appears to play a crucial role in the insertion of secretory and membrane polypeptides into the ER. It is required for assembly of membrane and secretory proteins. Found to be tightly associated with membrane-bound ribosomes, either directly or through adaptor proteins. Belongs to the SecY/SEC61-alpha family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 10p14

Cellular Component: cytosol

Research Articles on SEC61A2

Similar Products

Product Notes

The SEC61A2 sec61a2 (Catalog #AAA1269213) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcatca aatttttaga agttatcaaa ccattctgtg cagttctacc agaaattcag aaaccggaaa ggaaaatcca gtttagagag aaggttctgt ggactgctat aacgctcttc attttcttag tgtgttgtca gatcccactg tttggaatca tgtcatcaga ttctgcagat cctttctact ggatgagagt tattctggct tccaatagag gaactttaat ggaattgggt atctccccaa ttgtaacatc tggtttgatt atgcagttgt tagctggagc caaaatcatt gaagttggag atacaccgaa agatagagct ttattcaatg gagcccagaa actgtttggt atgatcatta ccattgggca agccattgtg tatgtcatga cggggatgta tggggaccct gcagaaatgg gtgctggaat ctgtctcctg atcatcattc agttgtttgt tgctggtttg attgtgctgc tgttagatga gctgctacag aagggttacg gcttggggtc tgggatttcc ctctttattg ccaccaacat ctgtgagacc attgtctgga aggcctttag tcccactacc attaacactg gcagaggtac tgagtttgag ggtgcagtca tagctctgtt ccatttgttg gccaccagga cggacaaagt ccgagcttta cgggaggctt tttatcggca gaacttaccc aatctcatga acctcattgc tacagttttt gtgtttgctg ttgttatata tttccaagga tttcgcgttg atctgcccat taagtcggcc cgttaccgag gacagtacag cagctacccc atcaaactct tctacacctc caacatcccc atcatcctcc agtcggccct ggtgtccaac ctgtatgtta tttcccagat gctgtctgtt cgatttagtg gcaacttttt agtaaattta ctaggacagt gggccgatgt cagtggggga ggacccgcac gttcttaccc agttggaggc ctttgttact atctttctcc tcctgagtcc atgggcgcca tctttgagga tcctgtccat gtcgttgttt atatcatctt catgttgggg tcatgtgcat tcttctctaa gacatggatt gaagtgtctg gttcctcagc caaagatgta gctaaacagc tgaaagaaca gcagatggta atgaggggcc accgagatac ctctatggtt catgagctta atagcgctag agcgtag. It is sometimes possible for the material contained within the vial of "SEC61A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.