Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TXNDC5 cdna clone

TXNDC5 cDNA Clone

Gene Names
TXNDC5; HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI
Synonyms
TXNDC5; TXNDC5 cDNA Clone; TXNDC5 cdna clone
Ordering
For Research Use Only!
Sequence
atgactcagtctgtagactccaacagagggaacaggaacgaaaaaaggtgtggacactgccagcggctgcagccgacttggaatgacctgggagacaaatacaacagcatggaagatgccaaagtctatgtggctaaagtggactgcacggcccactccgacgtgtgctccgcccagggggtgcgaggataccccaccttaaagcttttcaagccaggccaagaagctgtgaagtaccagggtcctcgggacttccagacactggaaaactggatgctgcagacactgaacgaggagccagtgacaccagagccggaagtggaaccgcccagtgcccccgagctcaagcaagggctgtatgagctctcagcaagcaactttgagctgcacgttgcacaaggcgaccactttatcaagttcttcgctccgtggtgtggtcactgcaaagccctggctccaacctgggagcagctggctctgggccttgaacattccgaaactgtcaagattggcaaggttgattgtacacagcactatgaactctgctccggaaaccaggttcgtggctatcccactcttctctggttccgagatgggaaaaaggtggatcagtacaagggaaagcgggatttggagtcactgagggagtacgtggagtcgcagctgcagcgcacagagactggagcgacggagaccgtcacgccctcagaggccccggtgctggcagctgagcccgaggctgacaagggcactgtgttggcactcactgaaaataacttcgatgacaccattgcagaaggaataaccttcatcaagttttatgctccatggtgtggtcattgtaagactctggctcctacttgggaggaactctctaaaaaggaattccctggtctggcgggggtcaagatcgccgaagtagactgcactgctgaacggaatatctgcagcaagtattcggtacgaggctaccccacgttattgcttttccgaggagggaagaaagtcagtgagcacagtggaggcagagaccttgactcgttacaccgctttgtcctgagccaagcgaaagatgaactttag
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,178 Da
NCBI Official Full Name
Homo sapiens thioredoxin domain containing 5 (endoplasmic reticulum), mRNA
NCBI Official Synonym Full Names
thioredoxin domain containing 5
NCBI Official Symbol
TXNDC5
NCBI Official Synonym Symbols
HCC2; ERP46; HCC-2; STRF8; PDIA15; UNQ364; ENDOPDI
NCBI Protein Information
thioredoxin domain-containing protein 5
UniProt Protein Name
Thioredoxin domain-containing protein 5
UniProt Gene Name
TXNDC5
UniProt Synonym Gene Names
TLP46; ER protein 46; ERp46
UniProt Entry Name
TXND5_HUMAN

NCBI Description

This gene encodes a protein-disulfide isomerase. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream MUTED (muted homolog) gene. [provided by RefSeq, Dec 2010]

Uniprot Description

TXNDC5: Possesses thioredoxin activity. Has been shown to reduce insulin disulfide bonds. Also complements protein disulfide- isomerase deficiency in yeast. Belongs to the protein disulfide isomerase family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6p24.3

Cellular Component: endoplasmic reticulum; lysosomal lumen

Molecular Function: protein binding; protein disulfide isomerase activity

Biological Process: apoptotic cell clearance; negative regulation of apoptosis; protein folding

Research Articles on TXNDC5

Similar Products

Product Notes

The TXNDC5 txndc5 (Catalog #AAA1269194) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcagt ctgtagactc caacagaggg aacaggaacg aaaaaaggtg tggacactgc cagcggctgc agccgacttg gaatgacctg ggagacaaat acaacagcat ggaagatgcc aaagtctatg tggctaaagt ggactgcacg gcccactccg acgtgtgctc cgcccagggg gtgcgaggat accccacctt aaagcttttc aagccaggcc aagaagctgt gaagtaccag ggtcctcggg acttccagac actggaaaac tggatgctgc agacactgaa cgaggagcca gtgacaccag agccggaagt ggaaccgccc agtgcccccg agctcaagca agggctgtat gagctctcag caagcaactt tgagctgcac gttgcacaag gcgaccactt tatcaagttc ttcgctccgt ggtgtggtca ctgcaaagcc ctggctccaa cctgggagca gctggctctg ggccttgaac attccgaaac tgtcaagatt ggcaaggttg attgtacaca gcactatgaa ctctgctccg gaaaccaggt tcgtggctat cccactcttc tctggttccg agatgggaaa aaggtggatc agtacaaggg aaagcgggat ttggagtcac tgagggagta cgtggagtcg cagctgcagc gcacagagac tggagcgacg gagaccgtca cgccctcaga ggccccggtg ctggcagctg agcccgaggc tgacaagggc actgtgttgg cactcactga aaataacttc gatgacacca ttgcagaagg aataaccttc atcaagtttt atgctccatg gtgtggtcat tgtaagactc tggctcctac ttgggaggaa ctctctaaaa aggaattccc tggtctggcg ggggtcaaga tcgccgaagt agactgcact gctgaacgga atatctgcag caagtattcg gtacgaggct accccacgtt attgcttttc cgaggaggga agaaagtcag tgagcacagt ggaggcagag accttgactc gttacaccgc tttgtcctga gccaagcgaa agatgaactt tag. It is sometimes possible for the material contained within the vial of "TXNDC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.