Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACAD11 cdna clone

ACAD11 cDNA Clone

Gene Names
ACAD11; ACAD-11
Synonyms
ACAD11; ACAD11 cDNA Clone; ACAD11 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaacaacacattcttccagctgaaaaggaggtaactgagttctatgttcaaaatgaaaattcagtggacaagtggggaaaacctttagtgattgataaactcaaggaaatggccaaagtcgagggtctctggaacttgtttttgccagctgtcagcggactcagccacgtggactatgccttgattgctgaagaaacaggaaaatgcttttttgctccagatgtctttaactgccaagcaccagacacagggaatatggaggttctgcacctgtatggaagtgaggaacagaagaaacagtggcttgagcctcttcttcaagggaacattacctcttgcttctgtatgacagaacctgatgtagcttcaagtgatgccacgaatattgaatgcagcatccaacgagatgaagatagctatgtaattaacggcaaaaaatggtggagcagtggagctgggaatcccaagtgcaaaattgcaattgttttgggaagaactcaaaatacttctctctccagacacaaacagcacagcatgattcttgttcccatgaacacacctggagtaaaaataataaggcctttgtcagtttttggctacacagataattttcatggaggacattttgagatccattttaatcaagtgcgagttcctgccacaaatctaatactaggtgaaggtaggggatttgaaatttcccaaggccgccttggacctggcagaatccaccactgtatgagaacagtaggtttggcggaacgcgctttgcagatcatgtgtgagcgggcaacacaaaggatagctttcaagaagaagttgtatgcacatgaggttgtggctcactggattgctgaaagccgcattgccattgagaagatccgcttgttgactctgaaagctgctcacagcatggacactctgggcagtgctggcgctaagaaagagattgcaatgatcaaagtggctgccccacgggctgtcagcaaaatcgttgactgggccatccaggtgtgcggaggtgctggtgtttcccaggattaccctctggctaacatgtatgctataacccgagttttgcgtttagcagatggacctgacgaagttcatctttcagcaatcgcaacaatggagctgcgggaccaagccaaaagactgacagccaagatataa
Sequence Length
1176
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,920 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase family, member 11, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase family member 11
NCBI Official Symbol
ACAD11
NCBI Official Synonym Symbols
ACAD-11
NCBI Protein Information
acyl-CoA dehydrogenase family member 11
UniProt Protein Name
Acyl-CoA dehydrogenase family member 11
UniProt Gene Name
ACAD11
UniProt Synonym Gene Names
ACAD-11
UniProt Entry Name
ACD11_HUMAN

NCBI Description

This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]

Uniprot Description

ACAD11: Acyl-CoA dehydrogenase, that exhibits maximal activity towards saturated C22-CoA. Belongs to the acyl-CoA dehydrogenase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; EC 1.3.99.-; Mitochondrial

Chromosomal Location of Human Ortholog: 3q22.1

Cellular Component: mitochondrial inner membrane; mitochondrial membrane; nucleus; peroxisome

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding; long-chain-acyl-CoA dehydrogenase activity; very-long-chain-acyl-CoA dehydrogenase activity

Biological Process: fatty acid beta-oxidation; fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis

Research Articles on ACAD11

Similar Products

Product Notes

The ACAD11 acad11 (Catalog #AAA1269112) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacaac acattcttcc agctgaaaag gaggtaactg agttctatgt tcaaaatgaa aattcagtgg acaagtgggg aaaaccttta gtgattgata aactcaagga aatggccaaa gtcgagggtc tctggaactt gtttttgcca gctgtcagcg gactcagcca cgtggactat gccttgattg ctgaagaaac aggaaaatgc ttttttgctc cagatgtctt taactgccaa gcaccagaca cagggaatat ggaggttctg cacctgtatg gaagtgagga acagaagaaa cagtggcttg agcctcttct tcaagggaac attacctctt gcttctgtat gacagaacct gatgtagctt caagtgatgc cacgaatatt gaatgcagca tccaacgaga tgaagatagc tatgtaatta acggcaaaaa atggtggagc agtggagctg ggaatcccaa gtgcaaaatt gcaattgttt tgggaagaac tcaaaatact tctctctcca gacacaaaca gcacagcatg attcttgttc ccatgaacac acctggagta aaaataataa ggcctttgtc agtttttggc tacacagata attttcatgg aggacatttt gagatccatt ttaatcaagt gcgagttcct gccacaaatc taatactagg tgaaggtagg ggatttgaaa tttcccaagg ccgccttgga cctggcagaa tccaccactg tatgagaaca gtaggtttgg cggaacgcgc tttgcagatc atgtgtgagc gggcaacaca aaggatagct ttcaagaaga agttgtatgc acatgaggtt gtggctcact ggattgctga aagccgcatt gccattgaga agatccgctt gttgactctg aaagctgctc acagcatgga cactctgggc agtgctggcg ctaagaaaga gattgcaatg atcaaagtgg ctgccccacg ggctgtcagc aaaatcgttg actgggccat ccaggtgtgc ggaggtgctg gtgtttccca ggattaccct ctggctaaca tgtatgctat aacccgagtt ttgcgtttag cagatggacc tgacgaagtt catctttcag caatcgcaac aatggagctg cgggaccaag ccaaaagact gacagccaag atataa. It is sometimes possible for the material contained within the vial of "ACAD11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.