NRSN1 cdna clone
NRSN1 cDNA Clone
Gene Names
NRSN1; VMP; p24
Synonyms
NRSN1; NRSN1 cDNA Clone; NRSN1 cdna clone
Sequence
atgagttcttgcagcaacgtctgtgggtccaggcaggcacaggctgcagctgagggtggttaccagcgctatggagtccggtcctacctgcaccagttttatgaggactgtacagcctcaatttgggagtatgaggatgatttccagatccaaagatcacctaacaggtggagctcagtattctggaaggttggactcatctcaggtacagtttttgtgatcctcggattgactgttctggcagtgggctttcttgtgccccccaaaatcgaagcatttggcgaagccgattttgtggtggtcgacacacatgctgtccagtttaacagtgctctggacatgtacaagctggcaggagctgttctcttctgcattggaggcacgtccatggcagggtgcctgctgatgtcggtgtttgtaaagagctactccaaagaagaaaaattcctccagcagaagtttaaagaacgaatcgcagacatcaaagcccacacccagccggttacaaaagctccagggccaggggaaacaaagattccagtcactttgtccagggttcaaaatgtccagcctctactggcaacctga
Sequence Length
588
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,475 Da
NCBI Official Full Name
Homo sapiens neurensin 1, mRNA
NCBI Official Synonym Full Names
neurensin 1
NCBI Official Symbol
NRSN1
NCBI Official Synonym Symbols
VMP; p24
NCBI Protein Information
neurensin-1
UniProt Protein Name
Neurensin-1
Protein Family
UniProt Gene Name
NRSN1
UniProt Synonym Gene Names
Vesicular membrane protein p24
UniProt Entry Name
NRSN1_HUMAN
Uniprot Description
NRSN1: May play an important role in neural organelle transport, and in transduction of nerve signals or in nerve growth. May play a role in neurite extension. Belongs to the VMP family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 6p22.3
Cellular Component: cell soma; cytoplasmic membrane-bound vesicle; growth cone; neuron projection; transport vesicle
Molecular Function: protein binding
Biological Process: nervous system development
Research Articles on NRSN1
Similar Products
Product Notes
The NRSN1 nrsn1 (Catalog #AAA1268989) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttctt gcagcaacgt ctgtgggtcc aggcaggcac aggctgcagc tgagggtggt taccagcgct atggagtccg gtcctacctg caccagtttt atgaggactg tacagcctca atttgggagt atgaggatga tttccagatc caaagatcac ctaacaggtg gagctcagta ttctggaagg ttggactcat ctcaggtaca gtttttgtga tcctcggatt gactgttctg gcagtgggct ttcttgtgcc ccccaaaatc gaagcatttg gcgaagccga ttttgtggtg gtcgacacac atgctgtcca gtttaacagt gctctggaca tgtacaagct ggcaggagct gttctcttct gcattggagg cacgtccatg gcagggtgcc tgctgatgtc ggtgtttgta aagagctact ccaaagaaga aaaattcctc cagcagaagt ttaaagaacg aatcgcagac atcaaagccc acacccagcc ggttacaaaa gctccagggc caggggaaac aaagattcca gtcactttgt ccagggttca aaatgtccag cctctactgg caacctga. It is sometimes possible for the material contained within the vial of "NRSN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
