Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HOMER2 cdna clone

HOMER2 cDNA Clone

Gene Names
HOMER2; CPD; ACPD; DFNA68; VESL-2; HOMER-2
Synonyms
HOMER2; HOMER2 cDNA Clone; HOMER2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagaacagcccatcttcaccacccgagcgcatgtcttccagattgaccccaacaccaagaagaactggatgcctgcgagcaagcaggcggtcaccgtttcctacttctatgatgtcacaaggaacagctatcggatcatcagtgtggacggagccaaggtgatcataaacagcacaatcacaccgaatatgaccttcaccaaaacgtcacagaagtttgggcagtgggccgacagcagagccaacacagtgtttggtttggggttttcctctgagcagcagctgacaaagtttgcagagaaattccaggaggtgaaagaagctgccaagatagccaaagacaagacgcaggagaaaatcgagacctcaagtaatcattcccaagcatccagtgtcaacgggacggacgatgaaaaggcctctcacgccggtccagccaacacacacctgaagtctgagaatgacaagctgaagattgccttgacgcagagcgcagccaacgtgaagaagtgggagatcgagctgcagacccttcgggagagcaatgcacggctgaccacagcactgcaggagtcggcagccagtgtggagcagtggaagaggcagttctccatctgccgtgatgagaatgaccggctccgcaacaagattgatgagctggaagaacaatgcagtgagatcaacagagagaaggagaagaacacgcagctgaagaggaggatcgaggagctggaggcagagctccgagaaaaggagacagagctgaaagatctccgaaaacaaagtgaaatcatacctcagctcatgtcagagtgcgaatatgtctctgagaagctagaggcggcagagagagacaatcaaaacctggaagacaaagtgcgttccttaaagacagacattgaggagagcaaataccgacagcgccacctgaaggtggagttgaagagcttcctggaggtgctggacgggaagattgacgacctgcatgacttccgccgagggctctccaagctgggcaccgataactag
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,467 Da
NCBI Official Full Name
Homo sapiens homer homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
homer scaffolding protein 2
NCBI Official Symbol
HOMER2
NCBI Official Synonym Symbols
CPD; ACPD; DFNA68; VESL-2; HOMER-2
NCBI Protein Information
homer protein homolog 2
UniProt Protein Name
Homer protein homolog 2
Protein Family
UniProt Gene Name
HOMER2
UniProt Synonym Gene Names
Homer-2
UniProt Entry Name
HOME2_HUMAN

NCBI Description

This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. The encoded protein is a postsynaptic density scaffolding protein. Alternative splicing results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 14. [provided by RefSeq, Jun 2011]

Uniprot Description

HOMER2: Postsynaptic density scaffolding protein. Binds and cross-links cytoplasmic regions of GRM1, GRM5, ITPR1, DNM3, RYR1, RYR2, SHANK1 and SHANK3. By physically linking GRM1 and GRM5 with ER-associated ITPR1 receptors, it aids the coupling of surface receptors to intracellular calcium release. May also couple GRM1 to PI3 kinase through its interaction with AGAP2. Isoforms can be differently regulated and may play an important role in maintaining the plasticity at glutamatergic synapses. Belongs to the Homer family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Actin-binding

Chromosomal Location of Human Ortholog: 15q24.3

Cellular Component: cell junction; cytoplasm; nucleolus; nucleus; plasma membrane; stereocilium bundle tip

Molecular Function: metabotropic glutatmate receptor binding; protein binding

Biological Process: metabotropic glutamate receptor signaling pathway; sensory perception of sound

Disease: Deafness, Autosomal Dominant 68

Research Articles on HOMER2

Similar Products

Product Notes

The HOMER2 homer2 (Catalog #AAA1268946) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagaac agcccatctt caccacccga gcgcatgtct tccagattga ccccaacacc aagaagaact ggatgcctgc gagcaagcag gcggtcaccg tttcctactt ctatgatgtc acaaggaaca gctatcggat catcagtgtg gacggagcca aggtgatcat aaacagcaca atcacaccga atatgacctt caccaaaacg tcacagaagt ttgggcagtg ggccgacagc agagccaaca cagtgtttgg tttggggttt tcctctgagc agcagctgac aaagtttgca gagaaattcc aggaggtgaa agaagctgcc aagatagcca aagacaagac gcaggagaaa atcgagacct caagtaatca ttcccaagca tccagtgtca acgggacgga cgatgaaaag gcctctcacg ccggtccagc caacacacac ctgaagtctg agaatgacaa gctgaagatt gccttgacgc agagcgcagc caacgtgaag aagtgggaga tcgagctgca gacccttcgg gagagcaatg cacggctgac cacagcactg caggagtcgg cagccagtgt ggagcagtgg aagaggcagt tctccatctg ccgtgatgag aatgaccggc tccgcaacaa gattgatgag ctggaagaac aatgcagtga gatcaacaga gagaaggaga agaacacgca gctgaagagg aggatcgagg agctggaggc agagctccga gaaaaggaga cagagctgaa agatctccga aaacaaagtg aaatcatacc tcagctcatg tcagagtgcg aatatgtctc tgagaagcta gaggcggcag agagagacaa tcaaaacctg gaagacaaag tgcgttcctt aaagacagac attgaggaga gcaaataccg acagcgccac ctgaaggtgg agttgaagag cttcctggag gtgctggacg ggaagattga cgacctgcat gacttccgcc gagggctctc caagctgggc accgataact ag. It is sometimes possible for the material contained within the vial of "HOMER2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.