Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIK3IP1 cdna clone

PIK3IP1 cDNA Clone

Gene Names
PIK3IP1; HGFL; hHGFL(S)
Synonyms
PIK3IP1; PIK3IP1 cDNA Clone; PIK3IP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgttggcctgggtacaagcattcctcgtcagcaacatgctcctagcagaagcctatggatctggaggctgtttctgggacaacggccacctgtaccgggaggaccagacctcccccgcgccgggcctccgctgcctcaactggctggacgcgcagagcgggctggcctcggcccccgtgtcgggggccggcaatcacagttactgccgaaacccggacgaggacccgcgcgggccctggtgctacgtcagtggcgaggccggcgtccctgagaaacggccttgcgaggacctgcgctgtccagagaccacctcccaggccctgccagccttcacgacagaaatccaggaagcgtctgaagggccaggtgcagatgaggtgcaggtgttcgctcctgccaacgccctgcccgctcggagtgaggcggcagctgtgcagccagtgattgggatcagccagcgggtgcggatgaactccaaggagaaaaaggacctgggaactctgggctacgtgctgggcattaccatgatggtgatcatcattgccatcggagctggcatcatcttgggctactcctacaagagggggaaggatttgaaagaacagcatgatcagaaagtatgtgagagggagatgcagcgaatcactctgcccttgtctgccttcaccaaccccacctgtgagattgtggatgagaagactgtcgtggtccacaccagccagactccagttgaccctcaggagggcagcaccccccttatgggccaggccgggactcctggggcctga
Sequence Length
792
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,632 Da
NCBI Official Full Name
Homo sapiens phosphoinositide-3-kinase interacting protein 1, mRNA
NCBI Official Synonym Full Names
phosphoinositide-3-kinase interacting protein 1
NCBI Official Symbol
PIK3IP1
NCBI Official Synonym Symbols
HGFL; hHGFL(S)
NCBI Protein Information
phosphoinositide-3-kinase-interacting protein 1
UniProt Protein Name
Phosphoinositide-3-kinase-interacting protein 1
UniProt Gene Name
PIK3IP1
UniProt Synonym Gene Names
HGFL
UniProt Entry Name
P3IP1_HUMAN

Uniprot Description

HGFL: Negative regulator of hepatic phosphatidylinositol 3- kinase (PI3K) activity. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 22q12.2

Molecular Function: protein binding

Biological Process: negative regulation of phosphoinositide 3-kinase activity; negative regulation of phosphoinositide 3-kinase cascade

Research Articles on PIK3IP1

Similar Products

Product Notes

The PIK3IP1 pik3ip1 (Catalog #AAA1268937) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgttgg cctgggtaca agcattcctc gtcagcaaca tgctcctagc agaagcctat ggatctggag gctgtttctg ggacaacggc cacctgtacc gggaggacca gacctccccc gcgccgggcc tccgctgcct caactggctg gacgcgcaga gcgggctggc ctcggccccc gtgtcggggg ccggcaatca cagttactgc cgaaacccgg acgaggaccc gcgcgggccc tggtgctacg tcagtggcga ggccggcgtc cctgagaaac ggccttgcga ggacctgcgc tgtccagaga ccacctccca ggccctgcca gccttcacga cagaaatcca ggaagcgtct gaagggccag gtgcagatga ggtgcaggtg ttcgctcctg ccaacgccct gcccgctcgg agtgaggcgg cagctgtgca gccagtgatt gggatcagcc agcgggtgcg gatgaactcc aaggagaaaa aggacctggg aactctgggc tacgtgctgg gcattaccat gatggtgatc atcattgcca tcggagctgg catcatcttg ggctactcct acaagagggg gaaggatttg aaagaacagc atgatcagaa agtatgtgag agggagatgc agcgaatcac tctgcccttg tctgccttca ccaaccccac ctgtgagatt gtggatgaga agactgtcgt ggtccacacc agccagactc cagttgaccc tcaggagggc agcacccccc ttatgggcca ggccgggact cctggggcct ga. It is sometimes possible for the material contained within the vial of "PIK3IP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.