Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRAPPC10 cdna clone

TRAPPC10 cDNA Clone

Gene Names
TRAPPC10; EHOC1; GT334; TMEM1; TRS30; EHOC-1; TRS130
Synonyms
TRAPPC10; TRAPPC10 cDNA Clone; TRAPPC10 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgcctctgaggagccgctgccgccggtgatctacaccatggagaacaagcccatcgtcacctgtgctggagatcagaatttatttacctctgtttatccaacgctctctcagcagcttccaagagaaccaatggaatggagaaggtcctatggccgggctccgaagatgattcacctagagtctaactttgttcaattcaaagaggagctgctgcccaaagaaggaaacaaagctctgctcacgtttcccttcctccatatttactggacagagtgctgtgataccgaagtgtataaagctacagtaaaagatgacctcaccaagtggcagaatgttctgaaggctcatagctctgtggactggttaatagtgatagttgaaaatgatgccaagaaaaaaaacaaaaccaacatccttccccgaacctctattgtggacaaaataagaaatgatttttgtaataaacagagtgacaggtgtgttgtgctctccgaccccttgaaggactcttctcgaactcaggaatcctggaatgccttcctgaccaaactcaggacattgcttcttatgtcttttaccaaaaacctaggcaagtttgaggatgacatgagaaccttgagggagaagaggactgagccaggctggagcttttgtgaatatttcatggttcaggaggagcttgcctttgttttcgagatgctgcagcagttcgaggacgccctggtgcagtacgacgaactggacgccctcttctctcagtatgtggtcaacttcggggccgggggtataaaatgtcctttccacaactcagtggcctgctggtga
Sequence Length
831
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,173 Da
NCBI Official Full Name
Homo sapiens trafficking protein particle complex 10, mRNA
NCBI Official Synonym Full Names
trafficking protein particle complex 10
NCBI Official Symbol
TRAPPC10
NCBI Official Synonym Symbols
EHOC1; GT334; TMEM1; TRS30; EHOC-1; TRS130
NCBI Protein Information
trafficking protein particle complex subunit 10
UniProt Protein Name
Trafficking protein particle complex subunit 10
UniProt Gene Name
TRAPPC10
UniProt Synonym Gene Names
EHOC1; TMEM1; EHOC-1; TRAPP subunit TMEM1
UniProt Entry Name
TPC10_HUMAN

NCBI Description

The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]

Uniprot Description

EHOC-1: a transport protein that may play role in vesicular transport from endoplasmic reticulum to Golgi. Part of the multisubunit TRAPP (transport protein particle) complex. Localizes in cis-Golgi complexes.

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytosol; integral to membrane

Molecular Function: protein binding; sodium ion transmembrane transporter activity

Biological Process: COPII coating of Golgi vesicle; intra-Golgi vesicle-mediated transport; sodium ion transport

Research Articles on TRAPPC10

Similar Products

Product Notes

The TRAPPC10 trappc10 (Catalog #AAA1268930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgcct ctgaggagcc gctgccgccg gtgatctaca ccatggagaa caagcccatc gtcacctgtg ctggagatca gaatttattt acctctgttt atccaacgct ctctcagcag cttccaagag aaccaatgga atggagaagg tcctatggcc gggctccgaa gatgattcac ctagagtcta actttgttca attcaaagag gagctgctgc ccaaagaagg aaacaaagct ctgctcacgt ttcccttcct ccatatttac tggacagagt gctgtgatac cgaagtgtat aaagctacag taaaagatga cctcaccaag tggcagaatg ttctgaaggc tcatagctct gtggactggt taatagtgat agttgaaaat gatgccaaga aaaaaaacaa aaccaacatc cttccccgaa cctctattgt ggacaaaata agaaatgatt tttgtaataa acagagtgac aggtgtgttg tgctctccga ccccttgaag gactcttctc gaactcagga atcctggaat gccttcctga ccaaactcag gacattgctt cttatgtctt ttaccaaaaa cctaggcaag tttgaggatg acatgagaac cttgagggag aagaggactg agccaggctg gagcttttgt gaatatttca tggttcagga ggagcttgcc tttgttttcg agatgctgca gcagttcgag gacgccctgg tgcagtacga cgaactggac gccctcttct ctcagtatgt ggtcaacttc ggggccgggg gtataaaatg tcctttccac aactcagtgg cctgctggtg a. It is sometimes possible for the material contained within the vial of "TRAPPC10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.