ASB3 cdna clone
ASB3 cDNA Clone
Gene Names
ASB3; ASB-3
Synonyms
ASB3; ASB3 cDNA Clone; ASB3 cdna clone
Sequence
atggattttacagaggcttacgcggacacgtgctctacagttggacttgctgccagggaaggcaatgttaaagtcttaaggaaactgctcaaaaagggccgaagtgtcgatgttgctgataacaggggatggatgccaattcatgaagcagcttatcacaactctgtagaatgtttgcaaatgttaattaatgcagattcatctgaaaactacattaagatgaagacctttgaaggtttctgtgctttgcatctcgctgcaagtcaaggacattggaaaatcgtacagattcttttagaagctggggcagatcctaatgcaactactttagaagaaacgacaccattgtttttagctgttgaaaatggacagatagatgtgttaaggctgttgcttcaacacggagcaaatgttaatggatcccattctatgtgtggatggaactccttgcaccaggcttcttttcaggaaaatgctgagatcataaaattgcttcttagaaaaggagcaaacaaggaatgccaggatgactttggaatcacacctttatttgtggctgctcagtatggcaagctagaaagcttgagcatacttatttcatcgggtgcaaatgtcaattgtcaagccttggacaaagctacacccttgttcattgctgctcaagagggacacacaaaatgtgtggagcttttgctctccagtggggcagatcctgatctttactgtaatgaggacagttggcagttacctattcatgcagctgcacaaatgggccatacaaaaatcttggacttgttaataccacttactaaccgggcctgtgacactgggctaaacaaagtaagccctgtttactcagcagtgtttgggggacatgaagattgcctagaaatattactccggaatggctacagcccagacgcccaggcgtgccttgtttttggattcagttctcctgtgtgcatggctttccaaaaggactgtgagttctttggaattgtgaacattcttttgaaatatggagcccagataaatgaacttcatttggcatactgcctgaagtacgagaagttttcgatatttcgctactttttgaggaaaggttgctcattgggaccatggaaccatatatatgaatttgtaaatcatgcaattaaagcacaagcaaaatataaggagtggttgccacatcttctggttgctggatttgacccactgattctactgtgcaattcttggattgactcagtcagcattgacacccttatcttcactttggagtttactaattggaagacacttgcaccagctgttgaaaggatgctctctgctcgtgcctcaaacgcttggattctacagcaacatattgccactgttccatccctgacccatctttgtcgtttggaaattcggtccagtctaaaatcagaacgtctacggtctgacagttatattagtcagctgccacttcccagaagcctacataattatttgctctatgaagacgttctgaggatgtatgaagttccagaactggcagctattcaagatggataa
Sequence Length
1557
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,775 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 3, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 3
NCBI Official Symbol
ASB3
NCBI Official Synonym Symbols
ASB-3
NCBI Protein Information
ankyrin repeat and SOCS box protein 3
UniProt Protein Name
Ankyrin repeat and SOCS box protein 3
Protein Family
UniProt Gene Name
ASB3
UniProt Synonym Gene Names
ASB-3
UniProt Entry Name
ASB3_HUMAN
NCBI Description
The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2011]
Uniprot Description
ASB3: Probable substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Recognizes TNFRSF1B. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2p16.2
Cellular Component: cytoplasm; nucleus; ubiquitin ligase complex
Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity
Research Articles on ASB3
Similar Products
Product Notes
The ASB3 asb3 (Catalog #AAA1268326) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttta cagaggctta cgcggacacg tgctctacag ttggacttgc tgccagggaa ggcaatgtta aagtcttaag gaaactgctc aaaaagggcc gaagtgtcga tgttgctgat aacaggggat ggatgccaat tcatgaagca gcttatcaca actctgtaga atgtttgcaa atgttaatta atgcagattc atctgaaaac tacattaaga tgaagacctt tgaaggtttc tgtgctttgc atctcgctgc aagtcaagga cattggaaaa tcgtacagat tcttttagaa gctggggcag atcctaatgc aactacttta gaagaaacga caccattgtt tttagctgtt gaaaatggac agatagatgt gttaaggctg ttgcttcaac acggagcaaa tgttaatgga tcccattcta tgtgtggatg gaactccttg caccaggctt cttttcagga aaatgctgag atcataaaat tgcttcttag aaaaggagca aacaaggaat gccaggatga ctttggaatc acacctttat ttgtggctgc tcagtatggc aagctagaaa gcttgagcat acttatttca tcgggtgcaa atgtcaattg tcaagccttg gacaaagcta cacccttgtt cattgctgct caagagggac acacaaaatg tgtggagctt ttgctctcca gtggggcaga tcctgatctt tactgtaatg aggacagttg gcagttacct attcatgcag ctgcacaaat gggccataca aaaatcttgg acttgttaat accacttact aaccgggcct gtgacactgg gctaaacaaa gtaagccctg tttactcagc agtgtttggg ggacatgaag attgcctaga aatattactc cggaatggct acagcccaga cgcccaggcg tgccttgttt ttggattcag ttctcctgtg tgcatggctt tccaaaagga ctgtgagttc tttggaattg tgaacattct tttgaaatat ggagcccaga taaatgaact tcatttggca tactgcctga agtacgagaa gttttcgata tttcgctact ttttgaggaa aggttgctca ttgggaccat ggaaccatat atatgaattt gtaaatcatg caattaaagc acaagcaaaa tataaggagt ggttgccaca tcttctggtt gctggatttg acccactgat tctactgtgc aattcttgga ttgactcagt cagcattgac acccttatct tcactttgga gtttactaat tggaagacac ttgcaccagc tgttgaaagg atgctctctg ctcgtgcctc aaacgcttgg attctacagc aacatattgc cactgttcca tccctgaccc atctttgtcg tttggaaatt cggtccagtc taaaatcaga acgtctacgg tctgacagtt atattagtca gctgccactt cccagaagcc tacataatta tttgctctat gaagacgttc tgaggatgta tgaagttcca gaactggcag ctattcaaga tggataa. It is sometimes possible for the material contained within the vial of "ASB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
