Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIAH1 cdna clone

SIAH1 cDNA Clone

Gene Names
SIAH1; SIAH1A
Synonyms
SIAH1; SIAH1 cDNA Clone; SIAH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccgtcagactgctacagcattacctaccggtacctcgaagtgtccaccatcccagagggtgcctgccctgactggcacaactgcatccaacaatgacttggcgagtctttttgagtgtccagtctgctttgactatgtgttaccgcccattcttcaatgtcagagtggccatcttgtttgtagcaactgtcgcccaaagctcacatgttgtccaacttgccggggccctttgggatccattcgcaacttggctatggagaaagtggctaattcagtacttttcccctgtaaatatgcgtcttctggatgtgaaataactctgccacacacagaaaaagcagaccatgaagagctctgtgagtttaggccttattcctgtccgtgccctggtgcttcctgtaaatggcaaggctctctggatgctgtaatgccccatctgatgcatcagcataagtccattacaaccctacagggagaggatatagtttttcttgctacagacattaatcttcctggtgctgttgactgggtgatgatgcagtcctgttttggctttcacttcatgttagtcttagagaaacaggaaaaatacgatggtcaccagcagttcttcgcaatcgtacagctgataggaacacgcaagcaagctgaaaattttgcttaccgacttgagctaaatggtcataggcgacgattgacttgggaagcgactcctcgatctattcatgaaggaattgcaacagccattatgaatagcgactgtctagtctttgacaccagcattgcacagctttttgcagaaaatggcaatttaggcatcaatgtaactatttccatgtgttga
Sequence Length
849
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,215 Da
NCBI Official Full Name
Homo sapiens seven in absentia homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
siah E3 ubiquitin protein ligase 1
NCBI Official Symbol
SIAH1
NCBI Official Synonym Symbols
SIAH1A
NCBI Protein Information
E3 ubiquitin-protein ligase SIAH1
UniProt Protein Name
E3 ubiquitin-protein ligase SIAH1
UniProt Gene Name
SIAH1
UniProt Synonym Gene Names
HUMSIAH; Siah-1
UniProt Entry Name
SIAH1_HUMAN

NCBI Description

This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

SIAH1: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Mediates E3 ubiquitin ligase activity either through direct binding to substrates or by functioning as the essential RING domain subunit of larger E3 complexes. Triggers the ubiquitin-mediated degradation of many substrates, including proteins involved in transcription regulation (MYB, POU2AF1, PML and RBBP8), a cell surface receptor (DCC), the cell-surface receptor-type tyrosine kinase FLT3, the cytoplasmic signal transduction molecules (KLF10/TIEG1 and NUMB), an antiapoptotic protein (BAG1), a microtubule motor protein (KIF22), a protein involved in synaptic vesicle function in neurons (SYP), a structural protein (CTNNB1) and SNCAIP. Confers constitutive instability to HIPK2 through proteasomal degradation. It is thereby involved in many cellular processes such as apoptosis, tumor suppression, cell cycle, axon guidance, transcription regulation, spermatogenesis and TNF-alpha signaling. Has some overlapping function with SIAH2. Induces apoptosis in cooperation with PEG3. Upon nitric oxid (NO) generation that follows apoptotic stimulation, interacts with S- nitrosylated GAPDH, mediating the translocation of GAPDH to the nucleus. GAPDH acts as a stabilizer of SIAH1, facilitating the degradation of nuclear proteins. Homodimer. Interacts with group 1 glutamate receptors GRM1 and GRM5. Interacts with DAB1, which may inhibit its activity. Interacts with UBE2E2. Interacts with PEG3. Interacts with GAPDH; leading to stabilize SIAH1. Component of some large E3 complex composed of UBE2D1, SIAH1, CACYBP/SIP, SKP1, APC and TBL1X. Interacts with UBE2I. Interacts with alpha- tubulin. Interacts with PEG10, which may inhibit its activity. Interacts with KHDRBS3. Interacts with SNCAIP and HIPK2. May be induced by p53/TP53, suggesting that it may be required to modulate p53/TP53 response. The relevance of such activity in vivo is however unclear and may not exist. Widely expressed at a low level. Down- regulated in advanced hepatocellular carcinomas. Inhibited by interaction with SNCAIP (isoform 2, but not isoform 1). May be inhibited by interaction with PEG10. Belongs to the SINA (Seven in absentia) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; Cell development/differentiation; Ligase; EC 6.3.2.19; Ubiquitin conjugating system; Motility/polarity/chemotaxis; EC 6.3.2.-; Apoptosis

Chromosomal Location of Human Ortholog: 16q12.1

Cellular Component: beta-catenin destruction complex; cytoplasm; cytosol; nucleus

Molecular Function: identical protein binding; protein binding; protein C-terminus binding; ubiquitin-protein ligase activity; zinc ion binding

Biological Process: anatomical structure morphogenesis; apoptosis; axon guidance; cellular protein metabolic process; nervous system development; neuron apoptosis; positive regulation of apoptosis; proteasomal ubiquitin-dependent protein catabolic process; protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; ubiquitin-dependent protein catabolic process

Research Articles on SIAH1

Similar Products

Product Notes

The SIAH1 siah1 (Catalog #AAA1268310) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccgtc agactgctac agcattacct accggtacct cgaagtgtcc accatcccag agggtgcctg ccctgactgg cacaactgca tccaacaatg acttggcgag tctttttgag tgtccagtct gctttgacta tgtgttaccg cccattcttc aatgtcagag tggccatctt gtttgtagca actgtcgccc aaagctcaca tgttgtccaa cttgccgggg ccctttggga tccattcgca acttggctat ggagaaagtg gctaattcag tacttttccc ctgtaaatat gcgtcttctg gatgtgaaat aactctgcca cacacagaaa aagcagacca tgaagagctc tgtgagttta ggccttattc ctgtccgtgc cctggtgctt cctgtaaatg gcaaggctct ctggatgctg taatgcccca tctgatgcat cagcataagt ccattacaac cctacaggga gaggatatag tttttcttgc tacagacatt aatcttcctg gtgctgttga ctgggtgatg atgcagtcct gttttggctt tcacttcatg ttagtcttag agaaacagga aaaatacgat ggtcaccagc agttcttcgc aatcgtacag ctgataggaa cacgcaagca agctgaaaat tttgcttacc gacttgagct aaatggtcat aggcgacgat tgacttggga agcgactcct cgatctattc atgaaggaat tgcaacagcc attatgaata gcgactgtct agtctttgac accagcattg cacagctttt tgcagaaaat ggcaatttag gcatcaatgt aactatttcc atgtgttga. It is sometimes possible for the material contained within the vial of "SIAH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.