DCUN1D5 cdna clone
DCUN1D5 cDNA Clone
Gene Names
DCUN1D5; SCCRO5
Synonyms
DCUN1D5; DCUN1D5 cDNA Clone; DCUN1D5 cdna clone
Sequence
atgccggtgaagaagaagagaaaatcccctggggtggcagcagcagtagcggaagacggaggcctcaaaaagtgtaaaatctccagctattgcagatcccaaccccctgctagactaataagtggagaggaacatttttcaagcaagaagtgcctggcttggttttatgaatatgcaggtcctgatgaagttgtagggccagaaggaatggaaaaattttgtgaagacattggtgttgaacctgaaaatattattatgttagttttagcgtggaaattggaggctgaaagcatgggattttttaccaaggaagaatggttaaagggaatgacttcattacagtgtgactgcacagaaaagttacaaaacaaatttgactttttgcgctcacagttgaatgatatttcgtcatttaagaatatctacagatatgcctttgattttgcaagggataaagatcagagaagccttgatattgatactgctaaatctatgttagctcttctgcttgggaggacatggccactgttttcagtattttaccagtacctggagcaatcaaagtatcgtgttatgaacaaagatcaatggtacaatgtattagaattcagcagaacagtccatgctgatcttagtaactatgatgaagatggtgcttggcctgttcttcttgatgaatttgttgagtggcaaaaagtccgtcagacatcatag
Sequence Length
714
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,508 Da
NCBI Official Full Name
Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
defective in cullin neddylation 1 domain containing 5
NCBI Official Symbol
DCUN1D5
NCBI Official Synonym Symbols
SCCRO5
NCBI Protein Information
DCN1-like protein 5
UniProt Protein Name
DCN1-like protein 5
Protein Family
UniProt Gene Name
DCUN1D5
UniProt Entry Name
DCNL5_HUMAN
Uniprot Description
DCUN1D5:
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 11q22.3
Cellular Component: ubiquitin ligase complex
Molecular Function: protein binding; small conjugating protein binding; ubiquitin conjugating enzyme binding
Biological Process: positive regulation of ubiquitin-protein ligase activity; protein neddylation
Research Articles on DCUN1D5
Similar Products
Product Notes
The DCUN1D5 dcun1d5 (Catalog #AAA1268269) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggtga agaagaagag aaaatcccct ggggtggcag cagcagtagc ggaagacgga ggcctcaaaa agtgtaaaat ctccagctat tgcagatccc aaccccctgc tagactaata agtggagagg aacatttttc aagcaagaag tgcctggctt ggttttatga atatgcaggt cctgatgaag ttgtagggcc agaaggaatg gaaaaatttt gtgaagacat tggtgttgaa cctgaaaata ttattatgtt agttttagcg tggaaattgg aggctgaaag catgggattt tttaccaagg aagaatggtt aaagggaatg acttcattac agtgtgactg cacagaaaag ttacaaaaca aatttgactt tttgcgctca cagttgaatg atatttcgtc atttaagaat atctacagat atgcctttga ttttgcaagg gataaagatc agagaagcct tgatattgat actgctaaat ctatgttagc tcttctgctt gggaggacat ggccactgtt ttcagtattt taccagtacc tggagcaatc aaagtatcgt gttatgaaca aagatcaatg gtacaatgta ttagaattca gcagaacagt ccatgctgat cttagtaact atgatgaaga tggtgcttgg cctgttcttc ttgatgaatt tgttgagtgg caaaaagtcc gtcagacatc atag. It is sometimes possible for the material contained within the vial of "DCUN1D5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
