Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRYM cdna clone

CRYM cDNA Clone

Gene Names
CRYM; THBP; DFNA40
Synonyms
CRYM; CRYM cDNA Clone; CRYM cdna clone
Ordering
For Research Use Only!
Sequence
atgagccgggtaccagcgttcctgagcgcggccgaggtggaggaacacctccgcagctccagcctcctcatcccgcctctagagacggccctggccaacttctccagcggtcccgaaggaggggtcatgcagcccgtgcgcaccgtggtgccggtgaccaagcacaggggctacctgggggtcatgcccgcctacagtgctgcagaggatgcactgaccaccaagttggtcaccttctacgaggaccgcggcatcacctcggtcgtcccttcccaccaggctactgtgctactctttgagcccagcaatggcaccctgctggcggtcatggatggaaatgtcataactgcaaagagaacagctgcagtttctgccattgccaccaagtttctgaaacctcccagcagtgaagtgctgtgcatccttggggctggggtccaggcctacagccattatgagatcttcacagagcagttctcctttaaggaggtgaggatatggaaccgcaccaaagaaaatgcagagaagtttgcagacacagtgcaaggagaggtacgggtctgttcttcggtccaggaggctgtggcaggtgcagatgtgatcatcacagtcaccctggcaacagagcccattttgtttggtgaatgggtgaagccaggggctcacatcaatgctgttggagccagcagacctgactggagagaactggatgatgagctcatgaaagaagctgtgctgtacgtggattcccaggaggctgccctgaaggagtctggagatgtcctgctgtcaggggccgagatctttgctgagctgggagaagtgattaagggagtgaaaccagcccactgtgagaagaccacggtgttcaagtctttgggaatggcagtggaagacacagttgcagccaaactcatctatgattcctggtcatctggtaaataa
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,776 Da
NCBI Official Full Name
Homo sapiens crystallin, mu, mRNA
NCBI Official Synonym Full Names
crystallin mu
NCBI Official Symbol
CRYM
NCBI Official Synonym Symbols
THBP; DFNA40
NCBI Protein Information
ketimine reductase mu-crystallin
UniProt Protein Name
Ketimine reductase mu-crystallin
Protein Family
UniProt Gene Name
CRYM
UniProt Synonym Gene Names
THBP
UniProt Entry Name
CRYM_HUMAN

NCBI Description

Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]

Uniprot Description

CRYM: Specifically catalyzes the reduction of imine bonds in brain substrates that may include cystathionine ketimine (CysK) and lanthionine ketimine (LK). Binds thyroid hormone which is a strong reversible inhibitor. Presumably involved in the regulation of the free intracellular concentration of triiodothyronine and access to its nuclear receptors. Belongs to the ornithine cyclodeaminase family.

Protein type: Lyase; EC 1.5.1.25

Chromosomal Location of Human Ortholog: 16p12.2

Cellular Component: cytoplasm; peroxisomal matrix

Molecular Function: NADP binding; protein binding; protein homodimerization activity; thiomorpholine-carboxylate dehydrogenase activity; transcription corepressor activity

Biological Process: lysine catabolic process; negative regulation of transcription from RNA polymerase II promoter; sensory perception of sound

Disease: Deafness, Autosomal Dominant 40

Research Articles on CRYM

Similar Products

Product Notes

The CRYM crym (Catalog #AAA1268210) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccggg taccagcgtt cctgagcgcg gccgaggtgg aggaacacct ccgcagctcc agcctcctca tcccgcctct agagacggcc ctggccaact tctccagcgg tcccgaagga ggggtcatgc agcccgtgcg caccgtggtg ccggtgacca agcacagggg ctacctgggg gtcatgcccg cctacagtgc tgcagaggat gcactgacca ccaagttggt caccttctac gaggaccgcg gcatcacctc ggtcgtccct tcccaccagg ctactgtgct actctttgag cccagcaatg gcaccctgct ggcggtcatg gatggaaatg tcataactgc aaagagaaca gctgcagttt ctgccattgc caccaagttt ctgaaacctc ccagcagtga agtgctgtgc atccttgggg ctggggtcca ggcctacagc cattatgaga tcttcacaga gcagttctcc tttaaggagg tgaggatatg gaaccgcacc aaagaaaatg cagagaagtt tgcagacaca gtgcaaggag aggtacgggt ctgttcttcg gtccaggagg ctgtggcagg tgcagatgtg atcatcacag tcaccctggc aacagagccc attttgtttg gtgaatgggt gaagccaggg gctcacatca atgctgttgg agccagcaga cctgactgga gagaactgga tgatgagctc atgaaagaag ctgtgctgta cgtggattcc caggaggctg ccctgaagga gtctggagat gtcctgctgt caggggccga gatctttgct gagctgggag aagtgattaa gggagtgaaa ccagcccact gtgagaagac cacggtgttc aagtctttgg gaatggcagt ggaagacaca gttgcagcca aactcatcta tgattcctgg tcatctggta aataa. It is sometimes possible for the material contained within the vial of "CRYM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.