MAEL cdna clone
MAEL cDNA Clone
Gene Names
MAEL; CT128; SPATA35
Synonyms
MAEL; MAEL cDNA Clone; MAEL cdna clone
Sequence
atgccgaaccgtaaggccagccggaatgcttactatttcttcgtgcaggagaagatccccgaactacggcgacgaggcctgcctgtggctcgcgttgctgatgccatcccttactgctcctcagactgggcgcttctgagggaggaagaaaaggagaaatacgcagaaatggctcgagaatggagggccgctcagggaaaggaccctgggccctcagagaagcagaaacctgttttcacaccactgaggaggccaggcatgcttgtaccaaagcagaatgtttcacctccagatatgtcagctttgtctttaaaaggtgatcaagctctccttggaggcattttttattttttgaacatttttagccatggcgagctacctcctcattgtgaacagcgcttcctcccttgtgaaattggctgtgttaagtattctctccaagaaggtattatggcagatttccacagttttataaatcctggtgaaattccacgaggatttcgatttcattgtcaggctgcaagtgattctagtcacaagattcctatttcaaattttgaacgtgggcataaccaagcaactgtgttacaaaacctttatagatttattcatcccaacccagggaactggccacctatctactgcaagtctgatgatagaaccagagtcaactggtgtttgaagcatatggcaaaggcatcagaaatcaggcaagatctacaacttctcactgtagaggaccttgtagtggggatctaccaacaaaaatttctcaaggagccctctaagacttggattcgaagcctcctagatgtggccatgtgggattattctagcaacacaaggtgcaagtggcatgaagaaaatgatattctcttctgtgctttagctgtttgcaagaagattgcgtactgcatcagtaattctctggccactctctttggaatccagctcacagaggctcatgtaccactacaagattatgaggccagcaatagtgtgacacccaaaatggttgtattggatgcagggcgttaccagaagctaagggttgggagttcaggattctctcatttcaactcttctaatgaggaacaaagatcaaacacacccattggtgactacccatctagggcaaaaatttctggccaaaacagcagcgttcggggaagaggaattacccgcttactagagagcatttccaattcttccagcaatatccacaaattctccaactgtgacacttcactctcaccttacatgtcccaaaaagatggatacaaatctttctcttccttatcttaa
Sequence Length
1305
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,268 Da
NCBI Official Full Name
Homo sapiens maelstrom homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
maelstrom spermatogenic transposon silencer
NCBI Official Symbol
MAEL
NCBI Official Synonym Symbols
CT128; SPATA35
NCBI Protein Information
protein maelstrom homolog
UniProt Protein Name
Protein maelstrom homolog
Protein Family
UniProt Gene Name
MAEL
UniProt Entry Name
MAEL_HUMAN
Uniprot Description
MAEL: Plays a central role during spermatogenesis by repressing transposable elements and prevent their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and govern the methylation and subsequent repression of transposons. Its association with piP-bodies suggests a participation in the secondary piRNAs metabolic process. Required for localization of germ-cell factors to the meiotic nuage. Belongs to the maelstrom family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: 1q24.1
Cellular Component: cytoplasm; nucleus
Molecular Function: sequence-specific DNA binding
Biological Process: DNA methylation during gametogenesis; male meiosis; negative regulation of transcription, DNA-dependent; RNA-mediated gene silencing; spermatogenesis
Research Articles on MAEL
Similar Products
Product Notes
The MAEL mael (Catalog #AAA1268046) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgaacc gtaaggccag ccggaatgct tactatttct tcgtgcagga gaagatcccc gaactacggc gacgaggcct gcctgtggct cgcgttgctg atgccatccc ttactgctcc tcagactggg cgcttctgag ggaggaagaa aaggagaaat acgcagaaat ggctcgagaa tggagggccg ctcagggaaa ggaccctggg ccctcagaga agcagaaacc tgttttcaca ccactgagga ggccaggcat gcttgtacca aagcagaatg tttcacctcc agatatgtca gctttgtctt taaaaggtga tcaagctctc cttggaggca ttttttattt tttgaacatt tttagccatg gcgagctacc tcctcattgt gaacagcgct tcctcccttg tgaaattggc tgtgttaagt attctctcca agaaggtatt atggcagatt tccacagttt tataaatcct ggtgaaattc cacgaggatt tcgatttcat tgtcaggctg caagtgattc tagtcacaag attcctattt caaattttga acgtgggcat aaccaagcaa ctgtgttaca aaacctttat agatttattc atcccaaccc agggaactgg ccacctatct actgcaagtc tgatgataga accagagtca actggtgttt gaagcatatg gcaaaggcat cagaaatcag gcaagatcta caacttctca ctgtagagga ccttgtagtg gggatctacc aacaaaaatt tctcaaggag ccctctaaga cttggattcg aagcctccta gatgtggcca tgtgggatta ttctagcaac acaaggtgca agtggcatga agaaaatgat attctcttct gtgctttagc tgtttgcaag aagattgcgt actgcatcag taattctctg gccactctct ttggaatcca gctcacagag gctcatgtac cactacaaga ttatgaggcc agcaatagtg tgacacccaa aatggttgta ttggatgcag ggcgttacca gaagctaagg gttgggagtt caggattctc tcatttcaac tcttctaatg aggaacaaag atcaaacaca cccattggtg actacccatc tagggcaaaa atttctggcc aaaacagcag cgttcgggga agaggaatta cccgcttact agagagcatt tccaattctt ccagcaatat ccacaaattc tccaactgtg acacttcact ctcaccttac atgtcccaaa aagatggata caaatctttc tcttccttat cttaa. It is sometimes possible for the material contained within the vial of "MAEL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
